CC BY
18study / B.M. Rau, I. Frigerio, M.W. Büchler [et al.] // Arch. Surg. — 2007. —Vol. 142(2). — P. 134-142.
18. Faix J.D. Biomarkers of sepsis / J.D. Faix. // Crit. Rev.Clin. Lab. Sci. — 2013. — Vol. 50(1).
19. Meisner M. Procalcitonin. A new innovative infectionparameter. Biochemical and clinical aspects / Meisner M. —New York: Georg Thieme Verlag, 2000. — 196 p.
20. Procalcitonin ratio indicates successful surgical treatmentof abdominal sepsis / A.R. Novotny, K. Emmanuel, N. Hueser[et al.] // Surgery. — 2009. — Vol. 145(1). — P. 20-26.
21. Serum C-reactive protein concentrations in early abdominal and pulmonary sepsis / J.A. Orati, P. Almeida, V. Santos [et al.] // Rev. Bras. Ter. Intensiva.
— 2013. — Vol. 25(1). —P. 6-11.
22. Serum procalcitonin and C-reactive protein levels asmarkers of bacterial infection: a systematic review and metaanalysis / L. Simon, F. Gauvin, D.K. Amre [et al.] // Clin. Infect. Dis. — 2004. — Vol. 39.
— P. 206-217.
23. Tall A.R. C-reactive protein reassessed / A.R. Tall // N. Engl. J. Med. — 2004. — № 350(14). — P. 1387-1397.
THE ROLE OF VITAMIN D IN PREDICTING THE DEVELOPMENT OF UROLITHIASIS IN
CHILDREN
Shamsiev A.
Samarkand state medical institute, Department of pediatric surgery, MD, professor
Yusupov Sh.
Samarkand state medical institute, Head of the department ofpediatric surgery, MD, professor
Pulotov P.
Samarkand state medical institute, Assistant of the Department ofpediatric surgery
Djalolov D.
Samarkand state medical institute, 5-year student of the faculty ofpediatrics
Shamsieva L.
Samarkand state medical institute, 5-year student of the faculty ofpediatrics
Abstract
The article examines the relationship of vitamin D to the development of urolithiasis in children.
Urolithiasis is polyetiological. The final link of stone formation is the crystallization of salts in a supersaturated solution of urine. But before this happens, various mechanisms will take part in the pathogenesis. These are disorders of renal blood circulation, disorders of urodynamics of the urinary tract, and the presence of inflammatory changes in them [2, 3].
According to the definition, urolithiasis is a metabolic disease caused by various endogenous and / or exogenous causes, characterized by the presence of a stone in the urinary system [3]. It is obvious that a stone in the urinary tract is only a clinical manifestation of the disease, which does not end with the removal of the stone, but continues to progress, if the causes that caused it have not been eliminated [10].
The most common are calcium stones, which account for at least 80%. At the same time, most of the calcium stones, about 85-90%, are calcium oxalates, 1-10% are calcium phosphates [5]. Recently, there is a tendency to decrease the share of phosphate stones in the overall structure all over the world. Most likely, this situation is the result of a decrease in the number of infected stones due to the spread of minimally invasive surgery urolithiasis and the use of modern antibacterial therapy [1,8].
Thus, metabolic disorders come to the fore and begin to play a key role in the pathogenesis of urolithiasis. Uric acid stones (up to 10% of all uric stones), which include uric acid and its salts, as well as mixed stones (up to 5% of all calcium stones), which contain calcium salts in combination with uric acid and/or its salts, have become more common [9].
One of the risk factors for the occurrence and recurrence of urolithiasis is a violation of calcium metabolism, the regulation of which in the human body is a complex process. Three main hormones are involved in maintaining calcium homeostasis: parathyroid hormone (PTH), calcitonin, and the most important metabolite of vitamin d 1,25-dihydroxy-cholecalciferol-1,25 [7].
Vitamin D is a powerful anabolic hormone with antioxidant properties and unique systemic metabolic effects [7]. On the one hand, there are seasonal fluctuations in vitamin D levels with high levels in summer and autumn and low levels in winter and spring (similar to annual testosterone cycles) [10]. On the other hand, the regulation of gene expression of hormone d metabolism changes according to the level of androgens. Accordingly, androgen deficiency increases the adverse health effects of vitamin d deficiency [6].
The vitamin D receptor is encoded by the VDR gene, which is characterized by genetic polymorphism, i.e. the existence of different allelic variants of this gene in the population [4]. The most significant polymorphisms of the VDR gene involved in the development of diseases were: Bsm I, Fok I, Taq I [9, 10]. Several studies have
linked the VDR gene polymorphism to urolithiasis. Published data demonstrating the significance of the presence of the ApalAA genotype, which determines sensitivity to vitamin D, in the development of calcium stones in the urinary organs [5, 8]. It is also reported that HLA B13, B22, and B35 genes are more common in urolithiasis patients than in healthy individuals [2].
Given the huge range of biological effects of vitamin D, its participation in carbohydrate, fat, purine metabolism, anabolic, antiproliferative, immunomodulatory effects, the need to fill its deficit can not be questioned.
Keywords: urolithiasis, vitamin D, DNA, gene polymorphism, VDR gene.
Purpose of the research: To study the content of urolithiasis (100 samples) and a control group of prac-
a polymorphic genetic marker the vitamin d receptor gene associated with the development and recurrence of urolithiasis in children.
Research materials and methods. To complete the tasks, we conducted a clinical examination of 100 children with urolithiasis and 100 practically healthy children, as well as collecting and analyzing statistical data on urolithiasis in a group of children of different age groups to identify the sexual, age, family frequency of urolithiasis, lifestyle and nutrition characteristics, as well as the seasonality of this pathological process. Ultrasound and x-ray examination of patients ' urinary organs.
The selection of patients was based on the diagnosis made in the clinic and the written consent of the proband. Collection of blood samples from patients with
tically healthy children (100 samples). Venous blood in the amount of 1 ml was taken in 0.5 ml of sodium citrate solution and stored in -20°C.
The material was collected on the basis of the Samarkand branch of pediatric surgery of the Republican Specialized scientific and practical medical center of Pediatrics.
Table 1 shows data on the distribution of patients by age in the groups under consideration. Table 1 shows that school - age children prevailed among the patients-69 (69%). This is due to the fact that it is at this age that metabolic disorders associated with the transition of children to General nutrition, drinking disorders, etc. are most often manifested, and in the younger group, nutrition remains relatively rational and metabolic changes are less apparent.
Table 1
Distribution of patients with urolithiasis and healthy children by age
Age Control group (n = 100) Main group (n = 100) Total (n = 200)
n % n % n %
0-3 years old 17 17 31 31 48 24
4-11 years old 43 43 43 43 86 43
12-17 years old 46 46 26 26 72 36
Table 2 shows the distribution of patients in both groups according to gender.
Table 2
Distribution of patients by gender
Control group Main group Total
Nosology (n = 100) (n = 100) (n = 200)
n % n % n %
Girls 3 3 32 32 35 17,5
Boys 97 97 68 68 165 82,5
From the data presented in table 2, it can be seen that according to the sexual distribution of patients, urolithiasis is more common among boys-68 (68%) of children than among girls-32 (32%).
The most characteristic complaints of patients with urolithiasis were pain in the lumbar region, increased body temperature, hematuria, turbidity of urine, increased or decreased urination. In some cases, acute urinary retention and spontaneous discharge of concretions were noted. In cases of dislocation of concretions in the n/W of the ureter, the pain was localized in the iliac region on the corresponding side. For patients with kidney failure, the typical symptoms were headache, poor appetite, and drowsiness.
Pain syndrome at admission was noted in 89 (89%) patients. At the same time, a pronounced pain syndrome - renal colic was observed in 15 (15%) patients. The localization and nature of the pain syndrome
depended on the age of the child, the presence of combined concretions in the urinary tract. Patients of the younger age group were characterized by abdominal pain. Older patients often complained of pain in the lumbar region, and sometimes indicated that pain radiated along the ureter.
In 3 (4.5%) children with concretion in the lower third of the right ureter, pain syndrome caused an unjustified appendectomy, which was performed at the place of residence. Ureterolithotomy in these patients was associated with certain technical difficulties due to the presence of the adhesive process.
Dysuric phenomena were observed in 28 (28%) patients and were most often characterized by frequent, painful urination. Acute urinary retention was observed in 5 (5%) patients. Dysuric phenomena in younger patients were almost 2 times more common than Acute urinary retention in all patients was resolved by in-
stalling an Ad'mer catheter, while 3 (3%) of patients after removing the catheter had spontaneous discharge of the concretion.
According to the localization of concretions, it was revealed: kidney stones in 43 patients (right-21, left-13, on both sides-9); ureteral stones in 12 patients (b/3 ureter - 1, C/3 ureter - 1, n/3 ureter - 10); bladder stones - 9 patients (1 of them recurrent bladder stone); stone of the hanging part of the urethra in 4 patients; multi-site urolithiasis in 10 patients. The combination of urolithiasis with abnormalities of the urinary system was detected in 22 children.
Genomic DNA was isolated from the whole blood of patients with a proven diagnosis of urolithiasis and practically healthy individuals of the control group according to a standard Protocol using a set of reagents Diatom ™ DNA Prep 200 (produced by "Isogen Laboratory" LLC). The principle of operation of this kit is based on the use of a lysing agent with guanidinthiocy-anate, which is designed to destroy cells, solubilize cellular debris, as well as denaturation of cell nucleases. In the presence of a lysing reagent, the DNA was sorbed on NucleoS ™ sorbent, then washed from salts and proteins with an alcohol solution. DNA eluted from the Extra-Genome ™ sorbent was directly used for further analysis.
PCR was performed using specific oligonucleotide primers and a set of reagents for PCR amplification
of GenePak ™ PCR Core DNA (produced by Isogen Laboratory LLC"). Master Mix tubes ready for amplification were used, which contain in the lyophilized state Taq DNA polymerase inhibited "for hot start", de-oxynucleosodtriphosphates and magnesium chloride with final concentrations, respectively, 1 u, 200 microns and 2.5 mM, as well as an oprimized buffer system for PCR amplification. The Master Mix tubes were added 5 ^l of a mixture of primers, with a final concentration of 0.5 ^m, 10 ^l of diluent PCR, and 5 ^l of the test DNA. GeneAmp ® PCR system 9700 with 96-cell block (Applied Biosystems). The amplification program for the VDR gene included 5 minutes of pre-de-naturation at 95 °C, followed by 34 cycles: 94 °C-30 s, 66 °C-30 s, 72 °C-30 s ; and a final elongation at 72 °C for 7 minutes. The temperature-time amplification mode for the Urokinase gene was as follows: 5 min of pre-denaturation at 95 °C, followed by 40 cycles: 95 °C-30 s, 56 °C-30 s, 72 °C-30 s; and final elongation at 72 °C for 7 min.
Results and discussion. Bioinformatic search for nucleotide sequences of these genes was performed in the genomic database "Ensemble Genome Browser". After PCR amplification of a fragment of the VDR gene, the products obtained by PCR were subjected to PDR analysis using Fok I endonuclease (produced by Sibenzim) (Fig. 1, table 1).
Fig. 1. Fok-I polymorphism of the VDR gene (Vitamin D receptor)
Table 1
Chromosomal localization and structure of the studied gene
Gene and polymorphism Name of primers Nucleotide sequence Restriction enzyme
Vitamin D receptor Fok-I polymorphism Pr VDR F AGCTGGCCCTGGCACTGACTCTGCTCT Fok I
Pr VDR R ATGGAAACACCTTGCTTCTTCTCCCTC
Interpretation of genotypes of VDR gene polymorphisms was performed based on different band patterns on an electrophoregram (Fig. 2).
Fig. 2. RFLP-analysis Fokl polymorphism of VDR gene
After photodocumentation, the resulting restricted fragmentary products were genotyped by the presence of certain fragments. Genotyping of PDRF analysis products (restriction products) of the VDR gene.
The presence of one fragment weight = 278 bp (BP) says that the sample carrier gomonimnaja geno-
type WT (Wild Type), and the presence of three fragments weight = 278 bp, 198 bp and 80 bp ( BP) - a sample of the heterozygous carrier genotype WT/MUT, the presence of two fragments weight = 198 bp and 80 bp (BP) - a sample carrier of a homozygous genotype MUT (Mutant) (Fig. 3).
>41 M 2 T 5' fr 7 ITT TO 11 '12 13 T4 15'16 17" 18 19 20 21 22 23-24.25.26.27- 28 29 30 3V 32 - 33-34 • 35-36 37 38 39
The frequency distribution of Fokl genotypes of the VDR gene polymorphism in the control group corresponds to the Hardy-Weinberg distribution.
A comparative analysis of the frequency distribution of Fokl genotypes of the VDR gene polymorphism revealed a statistically significant Association (p=0.02) of the f allele according to the dominant inheritance model (total Ff +ff genotypes) in the urolithiasis group compared with the corresponding indicator in the control group.
As can be seen from the diagram of the genotype of heterozygotes F/F of the Fokl polymorphism of the VDR gene was most often registered in the control group-53%, and in the group of children with urolithiasis, a tendency to decrease was established, but there was no confidence between the indicators - 47% (p>0.05). The most informative in urolithiasis is the F/f+f / f genotype of the Fokl polymorphism of the VDR gene, which is almost 2 times more common in relation to the control group data (P<0.01).
The frequency of distribution of the genotype of heterozygotes F/F was 44.4%, and in the control group 15%, respectively (x2 =0.47; p=0.24; OR=1.35; 95% CI 0.57-3.17; df=1). Detection of the f allele increased the risk of urolithiasis in children by 2.4 times, compared with the presence of the F allele (95% CI = 0.682.93, df=1).
The allele that determines the synthesis of the vitamin d receptor (427 amino acids) is designated as *f, while the shorter version of the receptor (424 amino ac-
ids) is designated as VDR*F. The study of patient samples showed that 83 patients had ff-normal genotype, in one case a homozygous variant of the mutant Ff genotype was detected, in 127 cases a heterozygous Ff genotype was detected by the polymorphic marker Fokl (3663T>C) of the VDR gene. The allelic variant VDR*F*f was associated with a frequency of 74% with manifestations of urolithiasis in the studied group of patients, the frequency of occurrence of the *f allele was 93 against the frequency of the * F-allele 89. It is known that calcium urolithiasis associated with genotype VDR*F*F, in individuals with this genotype significantly more likely to be symptoms of kidney stones at an early age, the carriers of VDR*f*f genotype Association with the development of urolith significantly lower, a individuals homozygous for VDR*F*f genotype - intermediate.
Analysis of the genotype frequencies of the VDR gene showed that the distribution of the analyzed genotypes in our population corresponds to the Hardy-Weinberg distribution (HWD) (x2=5,14; p=0,03) (табл. 3).
The molecular genetic method of predicting the occurrence of urolithiasis allows us to detect a predisposition to the disease at any age, since the genotype of a particular individual does not change during life. In addition, predisposition to the disease can be established using this method in the absence of any clinical or biochemical manifestations, that is, at the earliest preclinical stage of the development of the pathology.
Table 3
Results of statistical analysis of the genetic Association of genotypes of the VDR gene with urolithiasis based on
Genotypes Case Control X2 P OR
n=100 n=94 Value 95% CI
Genotype F/F 0,370 0,532 5,14 0,02 0,52 0,29-0,92
Genotype F/f+f/f 0,630 0,468 1,93 1,09-3,43
This means that the earlier the presence of a genetic marker is revealed, the more reliable and timely will be the measures to prevent the disease.
The molecular genetic method for predicting the onset of urolithiasis makes it possible to identify a predisposition to the disease at any age, practically from the birth of a person, since the genotype of a particular individual does not change throughout life. In addition, the predisposition to the disease can be established using this method in the absence of any clinical or biochemical manifestations, that is, at the earliest preclin-ical stage of the development of pathology. This means that the earlier the presence of a genetic marker is revealed, the more reliable and timely will be the measures to prevent the disease.
Thus, the results obtained in this study indicate that the VDR gene contributes to the determination of disorders that contribute to the development of urolithi-asis.
Conclusions
1. Comparative analysis of the frequency distribution of Fok1 genotypes of the VDR gene polymorphism revealed a statistically significant association (p = 0.02) of the f allele according to the dominant inheritance model (total Ff + ff genotypes) in the group of patients
with urolithiasis compared with the corresponding indicator in the control group was 63%.
2. In the Uzbek population, genetic markers of susceptibility to urolithiasis are: Ff + ff genotypes of the VDR gene. It is considered appropriate to include testing of this genotype in a comprehensive program for the prevention of urolithiasis in Uzbekistan.
References
1. Аполихин О.И., Сивков А.В., Константинова О.В., Сломинский П.А., Тупицына Т.В. Кали-ниченко Д.Н. Ассоциация мочекаменной болезни у пациентов с различными состояниями семейного анамнеза по уролитиазу с полиморфизмами его кандидитных генов в российской популяции // Экспериментальная и клиническая урология 2014;(3):50-52.
2. Аполихин О.И., Сивков А.В., Константинова О.В., Сломинский П.А., Тупицына Т.В. Кали-ниченко Д.Н. Связь одностороннего и двустороннего уролитиаза с генетическими факторами // Экспериментальная и клиническая урология 2015;(2):68-70.
3. Юсупов Ш.А. и др. Оценка интенсивности синдрома эндогенной интоксикации у детей с распространенным аппендикулярным перитонитом //Медицинский альманах. - 2019. - №. 5-6. - С. 5761.
4. Шамсиев А. М. и др. ЭКСТРЕННАЯ ВИДЕОБРОНХОСКОПИЯ В ДИАГНОСТИКЕ И ЛЕЧЕНИИ ИНОРОДНЫХ ТЕЛ ДЫХАТЕЛЬНЫХ ПУТЕЙ У ДЕТЕЙ //Детская хирургия. - 2020. - Т. 24. - №. S1. - С. 93-93.
5. Blomberg J.M. Vitamin D metabolism, sex hormones, and male reproductive function // Reproduction. 2012. Vol. 144. № 2. P. 135-152.
6. Girgis C.M., Baldock P.A., Downes M. Vitamin D, muscle and bone: integrating effects in development, aging and injury // Mol. Cell. Endocrinol. 2015. Vol. 410. P. 10-13.
7. Holick M.F., Binkley N.C., Bischoff-Ferrari H.A. et al. Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline // J. Clin. Endocrinol. Metab. 2011. Vol. 96. № 7. P. 1911-1930.
8. Skolarikos A., Straub M., Knoll T. et al. Metabolic evaluation and recurrence prevention for urinary stone patients: EAU guidelines // Eur. Urol. 2015. Vol. 67. № 4. P. 750-763.
9. Wehr E., Pilz S., Boehm B.O. et al. Association of vitamin D status with serum androgen levels in men // Clin. Endocrinol. (Oxf.). 2010. Vol. 73. № 2. P. 243-248.
10. Xu H., Zisman A.L., Coe F.L., Worcester E.M. Kidney stones: an update on current pharmacological management and future directions // Expert Opin. Pharmacother. 2013. Vol. 14. № 4. P. 435-447.
FORMING DIALOGICAL COMMUNICATION IN THE HIGHER SCHOOL EDUCATIONAL
PROCESS
Godovanets O., Kitsak T., Honcharenko V.
Higher State Educational Establishment of Ukraine "Bukovinian State Medical University ", Chernivtsi Department of Pediatric Dentistry
Abstract
The article presents examples of communicative competence in the process of studying in higher education, the importance of dialogue interaction for activating the intellectual and creative activity of students and internists.
Keywords: educational process, pedagogical thinking, dialogue communication, communicative competence.
The doctor should know medicine. This is an axiom. But in addition to knowledge, he must have certain human qualities. Napoleon I loved to repeat: "I do not believe in medicine, but I believe in my doctor Corvisart." Modern students are well-orientated in the world of communications, accustomed to new ways of seeking information, are able to use a variety of technological innovations, but often look ignorant, because they are not able to correctly and structurally express their knowledge, argue and convincingly defend their point of view.
In the 17th century, meeting on the case conference at the patient's bedside, the doctors were exchanging abuses, poking their tongues out at each other, and even often fighting. It was not by chance that their "prestige" was eternalized by Molière in those days. At that time, medicine was far from science: the tongue poked out replaced the scientific argument. If the culture of dialogue is not formed, opponents begin to talk over each other, get offended, the dialogue turns into several parallel streams of information and is rarely likely to produce good results.
In the modern world, there is an ever more severe shortage of lively dialogue that is so crucial to the educational process. Therefore, the role of the teacher in the educational process and his/her influence on the formation of the culture of students and interns is higher than ever. The requirements for the personality of the teacher and professor, his/her morality are reaching a
qualitatively new level. The minimum and at the same time the maximum goal of the teacher should be to be human and to understand that there is no such student who could not be respected. Therefore, in our opinion, the teacher, first of all, should be a humanist, regardless of what subject he teaches. Humanistically oriented pedagogical thinking chooses a person as the highest value of society, which is also determined by the main Law of our country, the Constitution, where Art. 3 states: "Human being, his or her life and health, honor and dignity, inviolability and security are recognized in Ukraine as the highest social value".
In modern philosophy and culture, the main characteristic of the humanistic ideal is the recognition of human individuality, and dialogue is perhaps the only possibility of its manifestation. From the point of view of hermeneutics, education should teach to understand. And the main thing the teacher should strive for is to prepare students for perception and understanding of otherness, understanding of the "other", different from themselves, to teach or at least direct students to experience sympathy and empathy [3, p. 55]. As noted by I. Sulima, in order for a person to succeed himself, he "must equally create, listen, look, read, and feel the created" [7, p. 37].
Of course, education is based on the principle of dialogue. This is the dialogue of the teacher and the student, and the essence of this is not only in the interac-
