CC BY
21
REVIEW COMMUNICATIONS
GENETICS
Organ-specific transcripts as a source of gene multifunctionality: lessons learned from
the Drosophila melanogaster sbr (Dm nxfl) gene
Ludmila Mamon1, Viktoria Ginanova1, Sergey Kliver2, Mariya Toropko1, and Elena Golubkova1
1Department of Genetics and Biotechnology, Faculty of Biology,
Saint Petersburg State University, Universitetskaya nab., 7-9, Saint Petersburg,
199034, Russian Federation
2Theodosius Dobzhansky Center for Genome Bioinformatics, Saint Petersburg State University, Sredniy Pr., 41, Saint Petersburg, 199004, Russian Federation
Address correspondence and requests for materials to Elena Golubkova, [email protected], [email protected]
Abstract
Citation: Mamon, L., Ginanova, V., Kliver, S., Toropko, M., and Golubkova, E. 2019. Organ-specific transcripts as a source of gene multifunctionality: lessons learned from the Drosophila melanogaster sbr (Dm nxfl) gene. Bio. Comm. 64(2): 146-157. https://doi.org/10.21638/spbu03.2019.206
Author's information: Ludmila Mamon, Dr. of Sci. in Biology, Professor, orcid. org/0000-0001-5338-0703; Viktoria Ginanova, PhD, Junior Researcher, orcid. org/0000-0002-8404-9893; Sergey Kliver, MSc, Junior Researcher, orcid.org/0000-0002-2965-3617; Mariya Toropko, student; Elena Golubkova, PhD, Associate Professor, orcid.org/0000-0002-9528-5760
Manuscript Editor: Anton Nizhnikov, Department of Genetics and Biotechnology, Faculty of Biology, Saint Petersburg State University, Saint Petersburg, Russia
Received: May 6, 2019;
Revised: June 17, 2019;
Accepted: June 20, 2019;
Copyright: © 2019 Mamon et al. This is an open-access article distributed under the terms of the License Agreement with Saint Petersburg State University, which permits to the authors unrestricted distribution, and self-archiving free of charge.
Funding: This work was supported by the Russian Foundation for Basic Research (19-04-01255 а).
Competing interests: The authors have declared that no competing interests exist.
Analysis of the transcriptomes of different organisms has demonstrated that a single gene can have multiple transcripts. The sources of transcriptional variability are the alternative promoters, polyadenylation sites, splicing, and RNA editing. A comparison of the organisms of different taxa has demonstrated that the complexity of organization during evolution arises not due to an increase in the number of protein-coding genes. The greatest variability of transcripts is specific to the nervous and germinal systems. A variety of mechanisms providing for the complexity of the transcriptome ensures a precise and coordinated regulation of organ-specific functions through a combination of cis-acting elements and trans-acting factors. The D. melanogaster sbr (Dm nxfl) gene has proven to be an excellent model for investigating mechanisms potentially leading to the emergence of multiple products with various functions. Keywords: nxf (nuclear export factor), D. melanogaster, alternative splicing, in-tron retention, transcriptional variability, alternative polyadenylation.
Contributors to Transcriptome Complexity
Analysis of the transcriptomes of different organisms has demonstrated that a single gene can have multiple transcripts. In Drosophila melanogaster, 47 genes can potentially code for more than 1000 transcript isoforms each (Brown et al., 2014). The sources of transcriptional variability are the alternative promoters, polyadenylation sites, splicing, and RNA editing. The same DNA sequence can encode both protein coding transcripts and non-coding RNAs, including regulatory antisense transcripts. The so-called nested genes provide an additional opportunity for an increased variability of transcripts that are products of the same genome locus. These can be separate genes located either on the same strand or on opposite strands within the host gene (Kumar, 2009). Such "nested" genes are located in intron 3 of the D. melanogaster sbr (small bristles) gene (Fig. 1). Ten exons and nine introns of the sbr gene with a length of 14341 bp are located in genomic region X:10,832,752..10,847,092 (FlyBase, 2019). Intron 3 (8892 nt) comprises 62 % of this gene sequence. Within this intron, there exist three genes: CG32669, CG15209, and CG15210. Initially they were predicted to be ORFs; their transcriptional activity was demonstrated later. The expression pattern and functions of these genes have been poorly investigated so far. One of them, CG32669, has the same orientation as the sbr gene, and the other two genes — CG15209 and CG15210 — are transcribed in the opposite direction.
CG15209
Fig. 1. The structure of the sbr (Dm nxfl) gene. The CG15210, CG15209 and CG32669 genes in intron 3 of the sbr gene.
Antisense transcripts that are complementary to the coding part of the gene are a common feature of tran-scriptomes. They include both long non-coding RNAs (lncRNAs) and short RNAs. Comprehensive analysis of the Drosophila transcriptome (Brown et al., 2014) has found both sense and antisense transcripts to be present in the same cell type at the same time. Sometimes antisense lncRNAs overlap with the 3' and 5' UTRs of adjacent genes, forming gene chains across contiguously transcribed regions. Antisense transcripts may overlap with both non-coding and coding sequences (CDSs). Moreover, orthologous genes have comparable antisense transcripts, which suggests a conserved regulation of gene expression with antisense transcripts (Brown et al., 2014).
The presence of paralogous genes with specific functions as a result of duplication followed by subsequent functional divergence may increase the flexibility of the gene expression network and, subsequently, adaptive reaction. The Nxf gene family is a good example of the research of the evolution of paralogous genes. Inside this family, only the Nxfl gene is homologous for all the species; other genes, even those sharing the same name, may be non-homologous in distant species. For example, the nxf3 of Drosophila is not homologous to the mammalian Nxf3 (Herold et al., 2001; Mamon et al, 2013), and the mouse Nxf3 is not orthologous to the human Nxf3 (Sasaki et al., 2005).
In mammals, the Nxf family includes genes with testis-specific and brain-specific expression (Jun et al., 2001; Tretyakova et al., 2005; Zhou et al., 2011). However, in D. melanogaster, the presence of organ-specific transcripts generated by different alternative events (such as the use of alternative promoters, alternative splicing, and polyadenylation) has been demonstrated only for the sbr (Dm nxf1) gene (Ivankova et al., 2010; Ginanova et al., 2016; Ginanova, 2017). An organ-specific pool of significantly different transcripts serves as the basis for the multifunctionality of the sbr gene. It is possible that certain tissue-specific functions are scattered throughout different paralogous genes in mammals.
Alternative sources of transcriptome complexity
DIFFERENTIAL PROMOTER USAGE
Core promoters consist of a variety of sequence elements, such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE), recognized by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex (Xu et al., 2016). No universal elements have been discovered in all core promoters, and the TATA box is found only in about 10 to 20 % of the metazoan core promoters (Kadonaga, 2012). The canonical basal transcription machinery, including RNA polymerase II (RNA-PII), interacts with the core promoter, typically located within -40 to +40 of the transcription start site (Kadonaga, 2002). The activity of the basal transcription machinery itself is quite low. Additional factors, such as activators or repressors with a variety of co-regulators (co-activators or co-repressors), are necessary for an effective transcription initiation by the RNAPII basal transcription machinery at the core promoter (Xu et al., 2016). These sequence-specific regulators of transcription are bound to regulatory DNA sequences, located at promoter-proximal or more distal regions. Transcription initiation efficiency of the RNAPII transcription machinery depends on the core promoter elements, combinatorial assortments of a variety of transcriptional activators or repressors, and chromatin modifications that can be navigated by RNAs, including miRNAs (Kadonaga, 2002, 2012).
Alternative promoter usage is yet another mechanism responsible for the complexity of the transcriptome and proteome (Vacik and Raska, 2017). If alternative promoters are located downstream of the canonical transcription start site, usually in one of the introns, they drive the expression of alternative RNA isoforms without upstream exons. As a result, some important functional domains coded for by the upstream exons will be lost in proteins coded for by alternative mRNA isoforms. Such shortened protein isoforms can be functionally distinct from the full-length protein, coded for by the canonical mRNA isoform.
ALTERNATIVE SPLICING
Alternative splicing (AS) is a common mechanism for increasing protein variety in eukaryotes (Black, 2000; Graveley, 2001; Nilsen and Graveley, 2010). Approximately 95 % of human genes are characterized by alternative pre-mRNA splicing (Wang et al., 2008). The major types of alternative splicing are exon "skipping" the use of exon cassettes that are sets of several adjacent exons with only a single exon from each cassette being chosen during the splicing of pre-mRNA, and the use of different 5' and 3' splice sites in exons or introns. A complex interplay of cis- and trans-acting factors promotes or represses the assembly of a splicing complex called a spliceosome at the splice site, and carries out the selection of canonic or an alternative 5' or 3' splice site. The spliceosome is a multi-protein-RNA complex, responsible for the precise excision of introns or intron/ exon blocks from the pre-mRNA and the fusion of the remaining exons together.
If the pre-mRNA of a gene undergoes alternative splicing of different types, the number of protein iso-forms may exceed the number of coding genes of the respective organism. The Drosophila Dscam (Down syndrome cell adhesion molecule) gene encoding axon guidance receptors are a great example thereof. This gene includes four exon cassettes of varying exon numbers, and can potentially generate over 38000 mRNA splice-isoforms. Different Dscam mRNAs probably label cell types or even single cells in the Drosophila brain (Schmucker, 2000; Graveley, 2005).
INTRON RETENTION
Intron retention (IR) is one of the variants of AS common in mammals. IR is considered to be a mechanism of gene expression regulation (Braunschweig et al., 2014; Jacob and Smith, 2017; Schmitz et al., 2017). IR enhances the complexity of the transcriptome (Schmitz et al., 2017). Within the main open reading frame, IR may result in the emergence of premature termination codons (PTCs), leading to the nonsense-mediated decay of mRNA with a retained intron, or, possibly, to the production of truncated proteins. mRNAs with retained introns give rise to alternative protein isoforms, and are therefore a source for the functional diversity of gene products. The existence of mRNA with an intron is a conservative feature of nxf1 genes in different organisms (Mamon et al., 2013, 2014; Wang et al., 2015). The retained intron may be part of the protein coding sequence, as in the Ce nxf1 mRNA, or it may only code for either the 17 C-terminus amino acids of the mammalian short NXF1 protein (Li et al., 2006) or the 5 C-terminus of the Drosophila short SBR (Mamon et al., 2013, 2014). The use of the PTC in the retained intron leads to the production of truncated proteins. In all cases, IR leads
to the emergence of mRNAs with an extended 3' UTR, including the canonical sequence of the Nxf1 mRNAs downstream of the retained intron. This suggests the presence of special regulatory functions related to the control of the spatial-temporal properties of mRNAs with a retained intron (Schmitz et al., 2017).
ALTERNATIVE POLYADENYLATION
The 3' end mRNA processing is a necessary step of mRNA maturation in eukaryotes, including endonucleolytic cleavage and untemplated polyadenylation. The cleavage and polyadenylation (CPA) machinery is composed of macromolecular complexes, such as the cleavage and polyadenylation stimulatory factor (CPSF), cleavage stimulatory factor (CStF), cleavage factor complexes — Im (CFIm) and IIm (CFIIm), and others (Proudfoot, 2011; Erson-Bensan, 2016). CPSF recognizes the polyadenylation signal (PAS), located ~10-30 nt upstream of the cleavage site. Most eukaryotic genes have multiple PASs used in alternative cleavage and polyadenylation (APA). There are two major PAS hexamers: AAUAAA and AUUAAA. Other weaker signal variants were later detected in different species: UAUAAA, AGUAAA, AA-GAAA, AAUAUA, AAUACA, CAUAAA, GAUAAA, AAUGAA, UUUAAA, ACUAAA, AAUAGA, AAAUAA, AUAAAA, AUAAAU, AUAAAG, CAAUAA, UAAUAA, AUAAAC, AAAAUA, AAAAAA, AAAAAG, AACAAA, UUAUAU, AAAAAU, and UUUAUU (Beaudoing et al., 2000; Tian et al., 2005; Derti et al., 2012; Sanfilippo et al., 2017). Such noncanonical PASs may be recognized by specific trans-acting factors and serve for alternative polyadenylation. The choice of the cleavage and polyad-enylation site is determined not only by PAS but also by the two motifs adjacent to it: U-rich/UGUA upstream elements (USEs) and the U-/GU-rich downstream element (DSE) (Colgan and Manley, 1997; Neve et al., 2017). The CstF complex interacts with DSE and mediates mRNA cleavage at the polyadenylation (pA) site (Neilson and Sandberg, 2010; Erson-Bensan, 2016). The CFIm complex binds to USE and mediates the cleavage reaction. The CFIIm complex promotes the termination of the RNA polymerase II-mediated transcription, and poly(A) polymerases (PAPs) catalyze the addition of untemplated adenosines downstream of the pA site (Proudfoot, 2011). The assembly process of the core factors of the cleavage and polyadenylation complex, including CPSF, CStF, CFIm, CFIIm, PAP, and others, is complicated by the interconnection between the 3' end processing with 5' capping, pre-mRNA splicing, and the transcription in the nucleus (Perales and Bentley, 2009; Szostak and Gebauer, 2012; Neve et al., 2017).
Depending on the location of the cleavage and polyadenylation (pA) site, APA events can be classified into two major groups: coding region APA (CR-APA) and UTR-
APA. CR-APA uses pA sites that are located within either CDS or the introns between CDS segments. As a result, alternative mRNA isoforms differ in their coding potential. UTR-APA uses the different pA sites that are located in the 3' UTR, and the resulting coding potential of alternative mRNA isoforms does not change (Neve et al., 2017).
The majority of genes contain multiple PASs in their 3' UTRs (Elkon et al., 2012); therefore, 3' UTR-APA may be a very common event, increasing the variability of transcripts at a transcriptome level. mRNA is usually a part of the ribonucleoprotein (RNP) complex of RNAs and RNA-binding proteins attracted by a combination of cis-acting elements in the 3' UTR or in another part of mRNA. The longer 3' UTRs may contain additional regulatory cis-acting elements that can regulate mRNA localization and protein abundance, or create conditions and act a scaffolding for recruiting a protein complex containing RNA-binding proteins (Berkovits and Mayr, 2015; Mitra et al., 2015).
The use of the proximal PAS in the 3' UTR may lead to a loss of cis-elements for binding with microRNAs and/or RNA-binding proteins (RBPs) (López de Salines et al., 2004; Flynt and Lai, 2008; Szostak and Gebauer, 2012; White et al., 2012). RBPs can recognize not only certain sequences, but also a specific secondary structure of the 3' UTR. RBP target sites in 3' UTR can overlap and form targets for miRNAs, and vice versa. In each case, mRNA's fate is determined by the combination of cis-elements in 3' UTR and the combination of transacting factors (RBP and miRNA). A different length of 3' UTR can serve as a mechanism for differential regulation of subcellular functions of the same proteins (An et al., 2008). There are two types of mRNA BDNF (brain-derived neurotrophic factor) with long 3' UTR and short 3' UTR in mice. It was shown that only the long 3' UTR provides the targeting mRNA BDNF to dendrites, controlling the abundance of the dendritic BDNF protein and the pruning and enlargement of dendritic spines. miRNAs binding sites in the 3' UTRs are cis-acting elements, which mediate mRNA decay and translational repression in animals (Iwakawa and Tomari, 2015). So, despite no changes in the protein-coding capacity difference in 3' UTR, it may be functionally significant and can influence the transport, stability, translation efficiency, and subcellular localization of mRNAs (Colgan and Manley, 1997; Hilger et al., 2011).
The length of 3' UTRs can change by increasing or decreasing the poly(A)-tail in the cytoplasm allowing for the regulation of the stability of mRNA and the efficiency of its translation (Richter, 1996). The cytoplasmic polyadenylation element (CPE) in 3' UTR is the binding site for the CPE-binding protein (CPEB) that promotes polyadenylation-induced translation. CPE (UUUUUAU) is located upstream of the nuclear PAS (AAUAAA). In Xenopus laevis, CPEB associates with Maskin, binding
the translation initiation factor 4E (Barnard et al., 2005). The interaction of Maskin with eIF4E excludes eIF4G and prevents the formation of the eIF4F initiation complex. Phosphorylation events within the CPE-binding protein complex disrupt its connection with the eIF4F initiation complex and allow the cytoplasmic poly(A) polymerase to elongate the poly(A) tail of mRNA. The elongated poly(A) tail is bound by the poly(A)-binding protein, which in turn binds eIF4G, disrupting the Maskin and eIF4E interaction, thereby initiating translation (Barnard et al., 2005; Richter and Sonenberg, 2005). Such strategy of translation regulation allows for the storage of mRNAs in a state of temporary unavailability for translation and for the activation of mRNA translation with the corresponding signal. This mechanism of translation regulation of specific mRNAs in cell cycle regulation (Barnard et al., 2005; Richter and Sonenberg, 2005) and the synapto-dendritic compartment of neurons (Wells et al., 2000; Du and Richter, 2005) has been found.
During the process of CR-APA, the use of an alternative PAS in an intron leads to the formation of a protein isoform without the C-terminus of a full-length protein. The U1snRNP actively suppresses PASs in introns. These PASs are called cryptic (Neve et al., 2017). However, these intronic PASs can become available during increased proliferation (Elkon et al., 2012). mRNAs with APA in the intron are a source of truncated proteins that are incapable of performing the functions of full-length proteins that are coded by the same gene. Identification of trans-acting APA regulators and cis-acting regulatory elements may promote understanding of the mechanisms of APA (White et al., 2012).
The majority of the sources of transcriptome complexity is the cornerstone of the origin of the sbr organ-specific transcripts.
ORGAN-SPECIFIC TRANSCRIPTS
The analysis of transcriptomes has made it possible to conclude that the greatest variability of transcripts is specific to the nervous and germinal systems. Genes expressed in the testes, brain, and ovaries have properties that promote the variability of transcriptomes.
BRAIN-SPECIFIC TRANSCRIPTS
The presence of mRNAs with an extended 3' UTR is a conserved feature of the nervous system in contrast to the testis transcripts (Miura et al., 2013, 2014; Hilger et al., 2011; Smibert et al., 2012). In the nervous system, hundreds of genes have mRNAs being processed with the use of increasingly distant PASs, and their 3' UTRs reach tens of kb in length (Hilgers, 2015). Specific RNA-binding proteins inhibit cleavage and polyadenylation (CPA) at proximal sites. In Drosophila, the ELAV (embryonic-lethal abnormal visual system) protein is known to play
I
Poly(U)-Tract
CCGCCUGAGGCUUUUAUGAAGUAAAUCGCAUAGGAGUUUCCGUAGGACAGAGCCGCGUGCCACAUCCACAUAAUCGAAUGCUGUUUUUUUUUUUUUGGUU major PAS
UUGUAAUUAAAUUUUAAAAUUAUUAGAGAAACCUCUAUAUAAUAAUAAUAAUUAAUAUUAUUAAGCUGCGAAGUUGUGUGCACAUUCGGGCAGUAGCAAU
UAUUAUCCCAGCACUGCGGGCAAUGUGCAUCAACGAUCACAGUUCUUCGAUAGAUUAGUUUAGCUCUCUUUAAGUUCCGUCCGCAGAUCCGCUGGUCUAC
miR-281-2-5p miR-184-3p
AUUGAGGCCAGGACGAGUCUGCGAACGGUAGUCCCUUUAGAGUUAAAGUUGUUUUAGAUUCCUAAGCCAAACACCUUCAAACACACACAACACGACAACA
major PAS CPE
CUAUUAAACGUAAUGCAACAAUGUUGUCGAAUCGAAAGAAACCCAAUUUUUAUUUUAAUAUAUACGACGAUACCGAAACCAAGGCGAUGGUCGAAAAGCA
miR-33-5p miR-iab-4-5p major PAS
UGGAUCGCGCCAAUAAUUCUAUAUUCCCCGCUUUCCCAGAUCCUCGACUCGCCUUACAUUUUGUAUACAAAUACCAUAGAAUAAAAAGAAACAUUUUGAC miR-1011-3p
CACUGUAAAAAUUUUGUAACGCUCGGAAACCAAAAUUACCUUUAUUUCUUAAUAGAAAAAAAUUAGUGUAAGAUUCGAUUUACAAUACACGCUUA
miR-965-3p
GCCG UAAAU UCAAU UG AAU U UAAUAUAUAAAAAU UAUAUACAU U AAG ACAAAAG UGUAGAU UCAUAAAUAAAU U U U UCAGAAUAGAAUG A miR-1006/10-3p
Fig. 2. Exon 10 sequence of the sbr gene. The end of the coding region is shown in bold. Arrows mark the ends of testis-specific transcripts detected by 3' RACE-PCR. Arrow head marks the 3' ends of the head and/or ovary transcripts. Important polyadenylation elements are depicted as poly(U)-tract, major PAS — major polyadenylation signal, CPE — cytoplasmic polyadenylation element. The sequences corresponding to predicted poorly conserved sites for conserved miRNA families are underlined.
Fig. 3. The testis-specific sbr mRNAs are detected by 5' and 3' RACE-PCR. Boxes indicate exons included in the sbr mRNAs. Exon numbers are signed under each box. RBD — RNA-Binding Domain; LRR — Leucine-Rich Domain; NTF2L — Nuclear Transport Factor 2 Like; UBA — Ubiquitin-Associated domain; NLS — Nuclear Localization Signal. In testes, all sbr mRNAs have the shortened 3' UTR. In all transcripts, length of the 3' UTR varies from 44 to 124 nucleotides. Two sbr mRNAs, using the alternative promoters in intron 3, give rise the shortened protein isoform without NLS and the part of RBD, which are present in the canonical full-length SBR.
the role of APA regulators. However, no binding sites for ELAV have been identified in the extended 3' UTRs (Hilger et al., 2012; Smibert et al., 2012). It was suggested that the distant APA depends on specific sequences in the promoters of genes producing mRNAs with an extended 3' UTR (Hilgers et al., 2012; Hilgers, 2015; Oktaba et al., 2015). A search of such sequences by means of computational analysis has revealed that the GAGA element is frequently found in the promoter regions of the genes producing mRNAs with extended 3' UTR (Li and Gilmour, 2013; Oktaba et al., 2015). The GAGA element signals pausing to the RNA Polymerase II (Pol II). This confirms the hypothesis that there exists interrelation between the processes of transcription initiation and CPA.
CStF-64 is a brain-specific CStF. CStF-64 is a splice variant of CStF and is found in all regions of the brain and the peripheral nervous system (MacDonald and McMahon, 2010). CStF-64 may play a role in determining the polyadenylation site in brain-specific mRNAs.
Interestingly, the hippocampus exhibits the largest number of 3' UTR extensions in comparison with all other tissues (Miura et al., 2013). 3' UTR lengthening may increase the number of cis-acting elements used as target sites for neural-specific miRNAs.
There are transcripts that undergo post-transcrip-tional cleavage to release specific fragments, which then function independently (Tuck and Tollervey, 2011), and 3' UTR extensions may be a source of ncRNAs after post-transcriptional cleavage (Miura et al., 2013). A significant increase in the 3' UTR length is observed in the sbr mRNA with retained intron 5. This intron was dubbed a cassette intron because it is part of the evolutionarily conserved cassette exon — 110 bp — intron — exon — 37 bp, which is found in the Nxfl genes in different organisms. mRNAs with a cassette intron are also found in organisms of different taxa (Mamon et al., 2013, 2014; Wang et al., 2015). Cassette introns contain evolutionarily conserved motifs. In Drosophilidae they are evident in the form of
Fig. 4. The sbr mRNAs are detected by 5' and 3' RACE-PCR in the head RNA probe. The symbols are the same as in Fig. 3. Horizontal arrows show the alternative transcription start sites, arrow heads show the alternative site of cleavage and polyadenylation. The sbr mRNAs isoforms are listed in order of decrease of their quantity.
Fig. 5. The sbr mRNA isoforms are detected by 5' and 3' RACE-PCR in the ovary RNA probe. The symbols are the same as in Fig. 3. Horizontal arrows show the alternative transcription start sites, arrow heads show the alternative site of cleavage and polyadenylation. The sbr mRNAs isoforms are listed in order of decrease of their quantity. The ovary-specific sbr mRNA isoforms are marked by asterisk.
two extended poly(A) sequences. Such poly(A)-tracts are known to facilitate the inclusion of corresponding introns into the processed RNA (Jacob and Smith, 2017).
It should be noted that the sbr gene's intron containing mRNA is the most abundant among the sbr transcripts in adult fly heads (Fig. 4). This is also supported by the results of a northern blot analysis, and suggests neurospecificity of the mRNAs with the retained intron (Ivankova et al., 2010). The sbr mRNA with the retained intron gives rise to a truncated protein (unpublished). The investigation of the role of the truncated SBR protein in the formation and function of the nervous system is currently underway.
TESTIS-SPECIFIC TRANSCRIPTS
Translational regulation is a fundamental characteristic of gene expression in mammalian testes (Kleene, 2001, 2003). Long-living mRNAs that are synthesized long
before translation have been found. They are stored in a translationally inactive state for several days, and are then translated in transcriptionally inactive elongated spermatids during the formation of spermatozoa from spermatids (Hawthorne et al., 2006). The widespread use of the alternative promoter, upstream PAS, and alternative splicing are features of gene expression in sper-matogenic cells (Kleene, 2001, 2003). In spermatogenic cells, the transcripts of some housekeeping genes encode truncated proteins that cannot have the same functions as the full-length products of the same genes in somatic cells (Kleene, 2001). Alternative promoter usage forms an alternative 5' UTR determining the efficiency of mRNA translation. Translation is repressed with the upstream reading frames (uORFs) in the 5' UTR before the start co-don (AUG) of the reading frame encoding the "functional" protein in the mRNA (Child et al., 1999). The presence of uORFs in mRNA's 5' UTR is an additional mechanism of the translation regulation in spermatogenesis (Kleene,
2003). Paralogous genes within gene families with only testes-specific expression are yet another feature of spermatogenesis. In mice, round spermatids express a testis-specific isoform of poly(A) polymerase, which is localized in the cytoplasm in contrast to the somatic isoform with the nuclear localization (Kashiwabara et al., 2000, 2002). Thus, cytoplasmic polyadenylation is an additional way of translation regulation of mRNAs during spermatogenesis (Kashiwabara et al., 2002; Kleene, 2003). There are testis-specific translation repressors, such as Y-box proteins and the testis-brain RNA binding protein (TB-RBP) in mammals (Kleene, 2003). It is an additional source allowing each mRNA to use its own mechanism of translational regulation. The specifics of a testis-specific transcrip-tome consist of transcripts of many genes, which are expressed in both somatic and spermatogenic cells, and are modified by alternative transcription start sites, splicing, and upstream polyadenylation sites, that form the atypical patterns of gene expression in spermatogenical cells (Kleene, 2001, 2003).
Mammalian and invertebrate testes use many mRNAs with shorter 3' UTRs compared to other tissues (Liu et al., 2007; Smibert et al., 2012; Neve et al., 2017). 3' UTR shortening promotes mRNA stability and transla-tional effectivity. It has been demonstrated that in mice, shortening the 3' UTR eliminates destabilizing elements, such as AU-rich elements and transposable elements located downstream of testis-specific APA (tsAPA) in 3' UTR (Li W. et al., 2016).
Since tsAPA is not used efficiently in somatic cells, it has been suggested that there are testis-specific factors involved in the cleavage and polyadenylation process in non-canonical proximal APAs, such as the testis-specif-ic form of CStF-64 (Wallace et al., 1999). The 64-kDa subunit of the CStF polyadenylation factor binds to pre-mRNAs downstream of the cleavage site and influences the cleavage site choice (MacDonald et al., 1994; MacDonald and McMahon, 2010). Somatic and testis-specific forms of CStF-64 have been found (Wallace et al., 1999). The CStF-64 gene for the somatic form is encoded on the X chromosome in both mice and humans. This suggests that the somatic form of CStF-64 is absent in meiotic cells because of the X chromosome in-activation, whereas the autosomal CStf2t gene encodes the testis-specific form xCStF-64 (Das et al., 2007). The xCStF-64 is found in spermatocytes and early spermatids (Wallace et al., 1999).
Alternative promoters in the intron 3 of the Dro-sophila melanogaster sbr (Dm nxf1) gene drive the expression of two testis-specific mRNA isoforms without exons 1, 2, and 3. 5' UTRs of these mRNAs isoforms contain either uORFs, or a small intron (Ginanova et al., 2016). Both features of the 5' UTR are known to control translation efficiency of the corresponding mRNAs in mammals (Mededbach et al., 2011; Bicknell et al., 2012);
their functionality in Drosophila is unknown. The testis-specific sbr mRNAs initiate the synthesis of the testis-specific short protein (tSBR), which excludes nuclear localization signals (NLS) present in the canonical SBR protein (Fig. 3). This suggests that tSBR is unable to get into the nucleus by itself and carries out some functions in the cytoplasm, likely participating in the biogenesis of long-living mRNAs during meiosis and spermiogenesis (Ginanova et al., 2016).
All sbr (Dm nxfl) mRNAs have a shortened 3' UTR in testes (Ginanova et al., 2016) (Fig. 2). The 3' UTR of the full-length sbr mRNAs has several cis-acting elements, such as AU-rich, alternative PASs, CPE, and the predicted target-sites for miRNAs. All of them are located downstream of the cleavage and polyadenylation sites, which are used during the processing of the testis-specific sbr mRNAs. The poly(U)-tract is among the cis-elements in the 3' UTR of sbr (Dm nxf1) mRNAs, and remains in the shortened 3' UTR of sbr (Dm nxf1) mRNAs. The polypyrimidine-tract-binding (PTB) protein 2 regulates meiotic male germ cell mRNAs in mice (Iguchi et al., 2006). The dmPTB plays an important role during spermatogenesis in Drosophila (Sridharan et al., 2016).
Testis-specific transcripts are unknown for the mammalian Nxf1 gene. There are testis-specific paralo-gous genes among Nxf gene family in mice (Sasaki et al., 2005) and humans (Yang et al., 2001).
TRANSCRIPTS IN OOGENESIS
A subset of maternal mRNAs and proteins are synthesized during oogenesis and are retained in the oocyte to direct the first mitotic divisions and specify the patterning of the embryo. Early embryogenesis passes through a stage when developmental control is handed from maternally provided gene products to those synthesized from (by) the zygotic genome (Tadros and Lipshitz, 2009). The oocyte-to-embryo transition (OET) can be subdivided into two interrelated processes: first, a subset of maternal mRNAs and proteins is eliminated; then the transcription of the zygotic genome begins.
There are several pathways of maternal mRNA degradation. One of them is the ARE (AU-rich element)-mediated pathway known in Xenopus laevis (Voeltz and Steitz, 1998). The Embryonic Deadenylation Element Binding Protein (EDEN-BP) triggers the deadenylation of maternal transcripts upon fertilization via the recognition of AU-rich cis-elements. The activity of EDEN-BP is regulated by phosphorylation (Detivaud et al., 2003). This may explain the different activity of EDEN-BP in oocytes and early embryos. Another way to mediate the maternal mRNA degradation is accomplished through the binding of a miRNA (Guo et al., 2008; Lund et al., 2009).
Yet another way of post-transcriptional regulation of the maternal mRNAs in early embryogenesis is the
CPE-dependent mRNA polyadenylation and its consequent translation. CPEB-mediated mRNA silencing/ re-activation is essential to oogenesis (Tay and Richter, 2001) and in developing hippocampal neurons (Kundel et al. 2009) in mice. Cytoplasmic polyadenylation is a major mRNA regulator during oogenesis and embryogenesis in Drosophila (Coll et al., 2010; Cui et al., 2013).
The sequence motifs in the 3' UTRs are the "combinatorial code" allowing for a precise spatial-temporal regulation of mRNA translation during OET (Evsikov et al. 2006), and the keys to a specific code combination are provided by a combination and/or modifications of the corresponding trans-acting factors with protective or destructive functions (Svoboda et al., 2015; Schultz et al., 2018).
The greatest variety of the sbr mRNAs is found in the ovaries (Fig. 5). Moreover, the canonical isoform is not the most numerous. Several different promoters are used as transcription starts for different mRNAs sbr. Alternative promoters are located in exons 2, 3, and 4 in addition to the canonical one. The sbr expression patterns in early embryos (0-2 h) and in the ovaries are similar, according to the northern blot analysis (Ivankova et al., 2010). One may hypothesize that the majority of sbr mRNA isoforms are transcribed during oogenesis, and the maternal products of the sbr gene are necessary during early development of the embryo. The mutations of the sbr gene have a maternal effect on early development. The SBR protein is abundant in early embryos and marks the spindles of nuclear divisions (Golubkova et al., 2015). The fraction of the shorter sbr mRNAs that is present in embryos 1-2 h of age disappears when zygotic transcription begins (Ivankova et al., 2010). These results imply an essential role of the sbr gene in the early embryogenesis of D. melanogaster. Since the early embryogenesis of D. melanogaster occurs in the absence of a transcription, the functions of SBR (Dm NXF1) as a factor of nuclear export of mRNAs are unnecessary. Nuclear division in syncytial embryos of D. melanogaster is characterized by semiclosed mitosis within the nuclear membranes, which are only disrupted at the poles adjacent to the centrioles (Stafstrom and Staehelin, 1984). The NPC (nuclear pore complex) assembly and disassembly at the site of fusion between the mitotic nuclear envelope and the overlying spindle membrane are detected during early synchronous mitosis in D. melanogaster embryos (Kiseleva et al., 2001). The predicted truncated products of the sbr gene during oogenesis can have alternative functions. The sbr gene products participate in complicated processes that can be relatively independent from transcription. These processes are provided by the cyclic translation of mRNAs of factors that are involved in DNA replication, nuclear divisions, and cytoskeleton dynamics.
A variety of SBR isoforms allow each of them to be part of a particular RNP complex that includes mRNAs for nuclear divisions in early embryos. mRNAs with dif-
ferent functional and regulatory capabilities require specialized RBPs. SBR (Dm NXF1) interacts with the sub-units of the origin recognition complex, which associates with replication origins and initiates the pre-replication complex assembly (Kopitova et al., 2016). The sbr gene is essential for nuclear divisions (Golubkova and Mamon, 2012) and the cytoskeleton (Mamon et al., 2017). Since the RNA-binding protein SBR is found not only in the nucleus or nuclear envelope but also in the cytoplasm, it may be part of RNP complexes storing organ-specific long-living mRNAs. The nucleoporin-binding domains in the truncated SBR isoforms allow for the localization of the corresponding RNP complexes in the nuclear envelope (Mamon et al., 2017).
The sbr mRNA diversity in ovaries reflects the specificity of the early embryonic development of D. melano-gaster. Various maternal mRNAs are involved in control of the synchronous nuclear divisions. The specific RNA-binding proteins are needed for functioning of different mRNA. This also applies to the SBR proteins.
Conclusion
A comparison of the organisms of different taxa has demonstrated that the complexity of organization during evolution arises not due to an increase in the number of protein-coding genes. One of the reasons is alternative transcript processing, which generates functional diversity from the same or similar number of genes. A variety of mechanisms providing for the complexity of the transcriptome ensures a precise and coordinated regulation of organ-specific functions through a combination of cis-acting elements and trans-acting factors. The D. melanogaster sbr (Dm nxf1) gene has proven to be an excellent model for investigating these mechanisms, potentially leading to the emergence of multiple products with various functions.
References
An, J.J., Gharami, K., Liao, G.-Y., Woo, N. H., Lau, A. G., Vanevs-ki, F., Torre, E. R., Jones, K. R., Feng, Y., Lu, B., and Xu, B. 2008. Distinct role of long 3'UTR BDNF mRNA in spine morphology and synaptic plasticity in hippocampal neurons. Cell 134(1):175-187. https://doi.org/10.1016/j. cell.2008.05.045 Barnard, D.C., Cao, Q., and Richter, J.D. 2005. Differential phosphorylation controls Maskin association with eu-karyotic translation initiation factor 4E and localization on the mitotic apparatus. Molecular and Cellular Biology 25(17):7605-7615. https://doi.org/10.1128/ MCB.25.17.7605-7615.2005 Beaudoing, E., Freier, S., Wyatt, J.R., Claverie, J.-M., and Gautheret, D. 2000. Patterns of variant polyadenylation signal usage in human genes. Genome Research 10:1001 — 1010. https://doi.org/10.1101/gr.10-7.1001 Berkovits, B. D. and Mayr, C. 2015. Alternative 3' UTRs act as scaffolds to regulate membrane protein localization. Nature 522:363-367. https://doi.org/10.1038/nature14321
Bicknell, A.A., Cenik, C., Chua, H.N., Roth, F.P., and Moore, M.J. 2012. Intron in UTRs: why we should stop ignoring them. Bioessays 34:1025-1034. https://doi. org/10.1002/bies.201200073 Black, D.L. 2003. Mechanisms of alternative pre-messenger RNA splicing. Annual Review of Biochemistry 72:291-336. https://doi.org/10.1146/annurev.bio-chem.72.121801.161720 Braunschweig, U., Barbosa-Morais, N.L., Pan, Q., Nach-man, E.N., Alipanahi, B., Gonatopoulos-Pournatzis, T., Frey, B., Irimia, M., and Blencowe, B.J. 2014. Widespread intron retention in mammals functionally tunes tran-scriptomes. Genome Research 24:1774-1786. https://doi. org/10.1101/gr.177790.1 14 Brown, J.B., Boley, N., Eisman, R., May, G.E., Stoiber, M.H., Duff, M. O., Booth, B. W., Wen, J., Park, S., Suzuki, A. M., Wan, K. H., Yu, C., Zhang, D., Carlson, J.W., Cherbas, L., Eads, B.D., Miller, D., Mockaitis, K., Roberts, J., Davis, C.A., Frise, E., Hammonds, A.S., Olson, S., Shen-ker, S., Sturgill, D., Samsonova, A.A., Weiszmann, R., Robinson, G., Hernandez, J., Andrews, J., Bickel, P.J., Carninci, P., Cherbas, P., Gingeras, T.R., Hoskins, R.A., Kaufman, T.C., Lai, E.C., Oliver, B., Perrimon, N., Grav-eley, B. R., and Celniker, S. E. 2014. Diversity and dynamics of the Drosophila transcriptome. Nature 512:393-399. https://doi.org/10.1038/nature12962 Child, S.J., Miller, M. K., and Geballe, A. P. 1999. Translational control by an upstream open reading frame in the HER-2/ neu transcript. Journal of Biological Chemistry 274:2433524341. https://doi.org/10.1074/jbc.274.34.24335 Colgan, D.F. and Manley, J.L. 1997. Mechanism and regulation of mRNA polyadenylation. Genes and Development 11:2755-2766. https://doi.org/10.1101/gad.11.21.2755 Coll, O., Villalba, A., Bussotti, G., Notredame, C., and Gebauer, F. 2010. A novel, canonical mechanism of cytoplas-mic polyadenylation operates in Drosophila embryogenesis. Genes and Development 24:129-134. https://doi. org/10.1101/gad.568610 Cui, J., Sartain, C.V., Pleiss, J., and Wolfner, M.F. 2013. Cytoplasmic polyadenylation is a major mRNA regulator during oogenesis and egg activation in Drosophila. Developmental Biology 383:121-131. https://doi.org/10.1016/j. ydbio.2013.08.013 Dass, B., Tardif, S., Park, J.Y., Tian, B., Weitlauf, H.M., Hess, R.A., Carnes, K., Griswold, M.D., Small, C.L., and MacDonald, C.C. 2007. Loss of polyadenylation protein TCstF-64 causes spermatogenic defects and male infertility. Proceeding of the National Academy of Science of USA 104:20374-20379. https://doi.org/10.1073. pnas.0707589104 Derti, A., Garrett-Engele, P., Maclsaac, K. D., Stevens, R. C., Sri-ram, S., Chen, R., Rohl, C.A., Johnson, J. M., and Babak, T. 2012. A quantitative atlas of polyadenylation in five mammals. Genome Research 22(6):1 173-1183. https:// doi.org/10.1101/gr.132563.111 Detivaud, L., Pascreau, G., Karaiskou, A., Osborne, H. B., and Kubiak, J.Z. 2003. Regulation of EDEN-dependent dead-enylation of Aurora A/Eg2-derived mRNA via phosphorylation and dephosphorylation in Xenopus laevis egg extracts. Journal of Cell Science 116:2697-2705. https://doi. org/10.1242/jcs.00477 Du, L. and Richter, J.D. 2005. Activity-dependent polyadenylation in neurons. RNA 11:340-1347. https://doi. org/10.1261/rna.2870505 Elkon, R., Drost, J., van Haaften, G., Jenal, M., Schrier, M., Oude Vrielink, J.A., and Agami, R. 2012. E2F mediates enhanced alternative polyadenylation in proliferation. Genome Biology 13:R59. https://doi.org/10.1186/gb-2012-13-7-r59
Erson-Bensan, A.E. 2016. Alternative polyadenylation and RNA-binding proteins. Journal of Molecular Endocrinology 57:F29-F34. https://doi.org/10.1530/JME-16-0070 Evsikov, A.V. and de Evsikova, C.M. 2009. Gene expression during the oocyte-to-embryo transition in mammals. Molecular Reproduction and Development 76(9):805-818. https://doi.org/10.1002/mrd.21038 Evsikov, A.V., Graber, J.H., Brockman, J.M., Hampl, A., Holbrook, A.E., Singh, P., Eppig, J.J., Solter, D., and Knowles, B. B. 2006. Cracking the egg: molecular dynamics and evolutionary aspects of the transition from the fully grown oocyte to embryo. Genes and Development 20:2713-2727. https://doi.org/10.1101/gad.1471006 Flynt, A.S. and Lai, E.C. 2008. Biological principles of mi-croRNA-mediated regulation: shared themes amid diversity. Nature Reviews Genetics 9:831-842. https://doi. org/10.1038/nrg2455 Ginanova, V., Golubkova, E., Kliver, S., Bychkova, E., Markos-ka, K., Ivankova, N., Tretyakova, I., Evgen'ev, M., and Mamon, L. 2016. Testis-specific products of the Drosophila melanogaster sbr gene, encoding nuclear export factor 1, are necessary for male fertility. Gene 577:153-160. https://doi.org/10.1016Zj.gene.2015.11.030 Ginanova V. 2017. Raznoobraznyye i tkanespetsifichnyye izo-formy Nxf1 (yadernogo faktora eksporta 1), osnovnogo faktora yadernogo eksporta mRNK u Drosophila melanogaster [Variety and tissue-specific isoforms of the Nxf1 (nuclear export factor 1), a main factor of nuclear export of mRNA in Drosophila melanogaster]. PhD thesis. St.-Pe-tersburg.
Golubkova, E. V., Atsapkina, A. A., and Mamon, L. A. 2015. The role of sbr /Dm nxfl gene in syncytial development in Drosophila melanogaster. Cell and Tissue Biology 9(4):271-283. https://doi.org/10.1134/S1990519X15040057 Golubkova, E.V. and Mamon, L.A. 2012. The role of Dm NXF1 in controlling early embryonic mitoses in Drosoph-ila melanogaster. Encyclopedia of Cell Biology Research 543-549. Nova Science Publishers. Inc. Graveley, B. R. 2001. Alternative splicing: increasing diversity in the proteomic world. Trends in Genetics 17:100-107. https://doi.org/10.1016/S0168-9525(00)02176-4 Graveley, B.R. 2005. Mutually exclusive splicing of the insect Dscam pre-mRNA directed by competing intronic RNA secondary structures. Cell 123:65-73. https://doi. org/10.1016/j.cell.2005.07.028 Guo, X., Gourronc, F., Audic, Y., Lyons-Levy, G., Mitchell, T., and Hartley, R. S. 2008. ElrA and AUF1 differentially bind cyclin B2 mRNA. Biochemical and Biophysical Research Communications 377:653-657. https://doi.org/10.1016/j. bbrc.2008.10.029 Hawthorne, S.K., Busanelli, R.R., and Kleen, K.C. 2006. The 5' UTR and 3' UTR of the sperm mitochondria-associated cysteine-rich protein mRNA regulate translation in spermatids by multiple mechanisms in transgenic mice. Developmental Biology 297:118-126. https://doi. org/10.1016/j.ydbio.2006.04.468 Herold, A., Klymenko, T., and Izaurralde, E. 2001. NXF1/ p15 heterodimers are essential for mRNA nuclear export in Drosophila. RNA 7:1768-1780. https://doi. org/10.1017.S1355838201013565 Hilgers, V. 2015. Alternative polyadenylation coupled to transcription initiation: Insights from ELAV-mediated 3' UTR extension. RNA Biology 12(9):918-921. https://doi.org/10 .1080/15476286.2015.1060393 Hilgers, V., Lemke, S.B., and Levine, M. 2012. ELAV mediates 3' UTR extension in the Drosophila nervous system. Genes and Development 26:2259-2264. https://doi. org/10.1101/gad.199653.112
Hilgers, V., Perry, M. W. Hednrix, D., Stark, A., Levine, M., and Haley, B. 2011. Neural-specific elongation of 3' UTRs during Drosophila development. Proceeding of the National Academy of Science of USA 108:15864-15869. https://doi. org/10.1073/pnas.1 112672108 Iguchi, N., Tobias, J.W., and Hecht, N. B. 2006. Expression profiling reveals meiotic male germ cell mRNAs that are translationally up- and down-regulated. Proceeding of the National Academy of Science of USA 103:7712-7717. https://doi.org/10.1073/pnas.0510999103 Ivankova, N., Tretyakova, I., Lyozin, G., Avanesyan, E., Zolotukh-in, A., Zatsepina, O. G., Evgen'ev, M. B., and Mamon, L. A. 2010. Alternative transcripts expressed by small bristles, the Drosophila melanogaster nxfl gene. Gene 458:11-19. https://doi.org/10.1016Zj.gene.2010.02.013 Iwakawa, H. O. and Tomari, Y. 2015. The functions of microR-NAs: mRNA decay and translational repression. Trends in Cell Biology 25:651-665. https://doi.org/10.1016/j. tcb.2015.07.011 Jacob, A.G. and Smith, C. W. 2017. Intron retention as a component of regulated gene expression programs. Human Genetics 136:1043-1057. https://doi.org/10.1007/ s00439-017-1791-x Johnson, J.M., Castle, J., Garrett-Engele, P., Kan, Z., Lo-erch, P.M., Armour, C.D., Santos, R., Schadt, E.E., Stoughton, R., and Shoemaker, D.D. 2003. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302:2141-2144. https://doi.org/10.1126/science.1090100 Jun, L., Frints, S., Duhamel, H., Herold, A., Abad-Rodrigues, J., Dotti, C., Izaurralde, E., Marynen, P., and Froyen, G. 2001. NXF5, a novel member of the nuclear RNA export factor family, is lost in a male patient with a syndromic form of mental retardation. Current Biology 11(18):1381-1391. https://doi.org/10.1016/S0960-9822(01)00419-5 Kadonaga, J.T. 2012. Perspectives on the RNA polymerase II core promoter. Wiley Interdisciplinary Reviews-Developmental Biology 1(1):40-51. https://doi.org/10.1002/wdev.21 Kadonaga, J.T. 2002. The DPE, a core promoter element for transcription by RNA polymerase II. Experimental and Molecular Medicine 34:259-264. https://doi.org/10.1038/ emm.2002.36
Kashiwabara, S., Zhuang, T., Yamagata, K., Noguchi, J., Fu-kamizu, A., and Baba, T. 2000. Identification of a novel isoform of poly(A) polymerase, TPAP, specifically present in the cytoplasm of spermatogenic cells. Developmental Biology 228:106-115. https://doi.org/10.1006/ dbio.2000.9894 Kashiwabara, S, Noguchi, J, Zhuang, T, Ohmura, K, Honda, A, Sugiura, S, Miyamoto, K, Takahashi, S, Inoue, K, Ogura, A, and Baba, T. 2002. Regulation of spermatogen-esis by testis-specific, cytoplasmic poly(A) polymerase TPAP. Science 298:1999-2002. https://doi.org/10.1126/ science.1074632 Kiseleva, E., Rutherford, S., Cotter, L. M., Allen, T. D., and Goldberg, M.W. 2001. Step of nuclear pore complex disassembly and reassembly during mitosis in early Drosophila embryos. Journal of Cell Science 114:3607-3618. Kleene, K.C. 2001. A possible meiotic function of the peculiar patterns of gene expression in mammalian spermatogenic cells. Mechanisms of Development 106:3-23. https://doi.org/10.1016/S0925-4773(01)00413-0 Kleene, K.C. 2003. Patterns, mechanisms, and functions of translation regulation in mammalian spermatogenic cells. Cytogenetic and Genome Research 103:217-224. https://doi.org/10.1159/000076807 Kopytova, D., Popova, V., Kurshakova, M., Shidlovskii, Y., Nabi-rochkina, E., Brechalov, A., Georgiev, G., and Georgie-
va, S. 2016. ORC interacts with THSC/TREX-2 and its sub-units promote Nxf1 association with mRNP and mRNA export in Drosophila. Nucleic Acids Research 44:49204933. https://doi.org/10.1093/nar/gkw192 Kumar, A. 2009. An overview of nested genes in eukary-otic genomes. Eukaryotic Cell 8:1321-1329. https://doi. org/10.1128/EC.00143-09 Kundel, M., Jones, K.J., Shin, C.Y., and Wells, D.G. 2009. Cyto-plasmic polyadenylation element binding protein regulates neurotrophin 3-dependent p-catenin mRNA translation in developing hippocampal neurons. Journal of Neuroscience 29:13630-13639. https://doi.org/10.1523/ JNEUROSCI.2910-08.2009 Li, J. and Gilmour, D.S. 2013. Distinct mechanisms of tran-scriptional pausing orchestrated by GAGA factor and M1BP, a novel transcription factor. The EMBO Journal 32:1829-1841. https://doi.org/10.1038/emboj.2013.111 Li, W., Park, J.Y.Zheng, D., Hoque, M.Yehia, G., and Tian, B. 2016. Alternative cleavage and polyadenylation in sper-matogenesis connects chromatin regulation with post-transcriptional control. BMC Biology 14:6. https://doi. org/10.1186/s12915-016-0229-6 Li, Y., Bor, Y. C., Fitzgerald, M. P., Lee, K. S., Rekosh, D., and Ham-marskjold, M.L. 2016. An NXF1 mRNA with a retained intron is expressed in hippocampal and neocortical neurons and is translated into a protein that functions as an Nxf1 cofactor. Molecular Biology of the Cell 27:3903-3912. https://doi.org/10.1091/mbc.E16-07-0515 Li, Y., Bor, Y. C., Misawa, Y., Xue, Y., Rekosh, D., and Hammar-skjold, M. L. 2006. An intron with a constitutive transport element is retained in a Tap messenger RNA. Nature 443:234-237. https://doi.org/10.1038/nature05107 Liu, D., Brockman, J.M., Dass, B., Hutchins, L.N., Singh, P., McCarrey, J. R., MacDonald, C.C., and Graber, J. H. 2007. Systematic variation in mRNA 3'-processing signals during mouse spermatogenesis. Nucleic Acids Research 35:234-246. https://doi.org/10.1093/nar/gkl919 López de Salines, I., Zhan, M., Lal, A., Yang, X., and Gorospe, M. 2004. Identification of a target RNA motif for RNA-bind-ing protein HuR. Proceeding of the National Academy of Science of USA 101:2987-2992. https://doi.org/10.1073. pnas.0306453101 Lund, E., Liu, M., Hartley, R. S., Sheets, M. D., and Dahlberg, J. S. 2009. Deadenylation of maternal mRNAs mediated by miR-427 in Xenopus laevis embryos. RNA 15:2351-2363. https://doi.org/10.1261/rna.1882009 MacDonald, C.C. and McMahon, K.W. 2010. Tissue-specific mechanisms of alternative polyadenylation: testis, brain, and beyond. Wiley Interdisciplinary Reviews-RNA 1:494-501. https://doi.org/10.1002/wrna.29 MacDonald, C.C., Wilusz, J., and Shenk, T. 1994. The 64-ki-lodalton subunit of the CstF polyadenylation factor binds to pre-mRNAs downstream of the cleavage site and influences cleavage site location. Molecular and Cellular Biology 14:6647-6654. https://doi.org/10.1128/ MCB.14.10.6647 Mamon, L.A., Kliver, S.F., and Golubkova, E.V. 2013. Evolutionary conserved features of the retained intron in alternative transcripts of the nxfl (Nuclear eXport Factor) genes in different organisms. Open Journal of Genetics 3:159-170. https://doi.org/10.4236/ojgen.2013.33018 Mamon, L. A., Kliver, S. F., Prosovskaya, A. O., Ginanova, V. R., and Golubkova, Ye.V. 2014. The intron-containing transcript: an evolutionarily conserved characteristic of the genes orthologous to nxfl (nuclear export factor 1). ISSN2079-0597. Russian Journal of Genetics and Applied Research 4(5):434-443. https://doi.org/10.1134/ S2079059714050104
Mamon, L. A., Ginanova, V. R., Kliver, S. F., Yakimova, A. O., At-sapkina, A.A., and Golubkova, E.V. 2017. RNA-binding proteins of the NXF (nuclear export factor) family and their connection with the cytoskeleton. Cytoskeleton 74:161-169. https://doi.org/10.1002/cm.21362 Medenbach, J., Seiler, M., and Hentze, M.W. 2011. Transla-tional control via protein-regulated upstream open reading frames. Cell. 145:902-913. https://doi.org/10.1016/j. cell.201 1.05.005 Mitra, M., Johnson, E.L., and Coller, H.A. 2015. Alternative polyadenylation can regulate post-translational membrane localization. Trends in Cell and Molecular Biology 10:37-47.
Miura, P., Sanfilippo, P., Shenker, S., and Lai, E.C. 2014. Alternative polyadenylation in the nervous system: to what lengths with 3' UTR extensions take us? BioEssays 36:766-777. https://doi.org/10.1002/bies.201300174 Miura, P., Shenker, S., Andreu-Agullo, C., Westholm, J. O., and Lai, E.C. 2013. Widespread and extensive lengthening of 3' UTRs in the mammalian brain. Genome Research 23:812-825. https://doi.org/10.1101/gr.146886.1 12 Neilson, J.R. and Sandberg, R. 2010. Heterogeneity in mammalian RNA 3' end formation. Experimental Cell Research 316:1357-1364. https://doi.org/10.1016/j.yex-cr.2010.02.040
Neve, J., Patel, R., Wang, Z., Louey, A., and Furger, A. M. 2017. Cleavage and polyadenylation: Ending the message expands gene regulation: Ending the message expands gene regulation. RNA Biology 14:865-890. https://doi.or g/10.1080/15476286.2017.1306171 Nilsen, T.W. and Graveley, B.R. 2010. Expansion of the eukaryotic proteome by alternative splicing. Nature 463:457-463. https://doi.org/10.1038/nature08909 Oktaba, K., Zhang, W., Lotz, T.S., Jun, D.J., Lemke, S.B., Ng, S.P., Esposito, E., Levine, M., and Hilgers, V. 2015. ELAV links paused Pol II to alternative polyadenylation in the Drosophila nervous system. Molecular Cell 57(2):341-348. https://doi.org/10.1016/j.molcel.2014.11.024 Perales, R. and Bentley, D. 2009. "Co-transcriptionality" — the transcription elongation complex as a nexus for nuclear transactions. Molecular Cell 36:178-191. https://doi. org/10.1016/j.molcel.2009.09.018 Proudfoot, N.J. 2011. Ending the message: poly(A) signals then and now. Genes and Development 25:1770-1782. https://doi.org/10.1101/gad.17268411 Richter, J.D. 1996. Dynamics of poly(A) addition and removal during development. pp 481-503 in J.W.B.Hershey, M.B.Mathews, and N.Sonenberg (eds) "Translational control". Cold Spring Harbor Laboratory Press. Plain-view. NY.
Richter, J.D. and Sonenberg, N. 2005.Regulation of cap-dependent translation by elF4E inhibitory proteins. Nature 433:477-480. https://doi.org/10.1038/nature03205 Sanfilippo, P., Wen, J., and Lai, E.C. 2017. Landscape and evolution of tissue-specific alternative polyadenylation across Drosophila species. Genome Biology 18:229. https://doi.org/10.1186/s13059-017-1358-0 Sasaki, M., Takeda, E., and Takano, K. 2005. Molecular cloning and functional characterization of mouse Nxf family gene products. Genomics 85:641-653. https://doi. org/10.1016/j.ygeno.2005.01.003 Schmitz, U., Pinello, N., Jia, F., Alasmari, S., Ritchie, W., Keight-ley, M.-C., Shini, S., Lieschke, G.J., Wong, J.J.-L., and Ras-ko, J.E.J. 2017. Intron retention enhances gene regulatory complexity in vertebrates. Genome Biology 18:216. https://doi.org/10.1186/s13059-017-1339-3 Schmucker, D., Clemens, J.C., Shu, H., Worby, C.A., Xiao, J., Muda, M., Dixon, J. E., and Zipursky, S. L. 2000. Drosophila
Dscam is an axon guidance receptor exhibiting extraordinary molecular diversity. Cell 101:671-684. https://doi. org/10.1016/S0092-8674(00)80878-8 Schultz, R.M., Stein, P., and Svoboda, P. 2018. The oocyte to embryo transition in mouse: past, present, and future. Biology of Reproduction 99:160-174. https://doi. org/10.1093/biolre/ioy013 Smibert, P., Miura, P., Westholm, J.O., Shenker, S., May, G., Duff, M. O., Zhang, D., Eads, B. D., Carlson, J., Brown, J. B., Eisman, R.C., Andrews, J., Kaufman, T., Cherbas, P., Celniker, S.E., Graveley, B.R., and Lai, E.C. 2012. Global patterns of tissue-specific alternative polyadenylation in Drosophila. Cell Reports 1:277-289. https://doi. org/10.1016/j.celrep.2012.01.001 Sridharan V., Heimiller J., Robida M.D., and Singh, R. 2016. High throughput sequencing identifies misregulated genes in the Drosophila polypyrimidine tract-binding protein (hephaestus) mutant defective in spermatogen-esis. PLoS One 11(3):e0150768. https://doi.org/10.1371/ journal.pone.0150768 Stafstrom, J. P. and Staehelin, L. A. 1984. Dynamics of the nuclear envelope and of nuclear pore complexes during mitosis in the Drosophila embryo. European Journal of Cell Biology 34:179-189. Svoboda, P., Franke, V., and Schultz, R.M. 2015. Chapter Nine — Sculpting the Transcriptome During the Oocyte-to-Embryo Transition in Mouse. Current Topics in Developmental Biology 113:305-349. https://doi.org/10.1016/ bs.ctdb.2015.06.004 Szostak, E. and Gebauer, F. 2012. Translational control by 3' -UTR-binding proteins. Briefings Functional Genomics 12:58-65. https://doi.org/10.1093/bfgp/els056 Tadros, W. and Lipshitz, H. D. 2009. The maternal-to-zygotic transition: a play in two acts. Development 136:30333042. https://doi.org/10.1242/dev.033183 Tay, J. and Richter, J.D. 2001. Germ cell differentiation and synaptonemal complex formation are disrupted in CPEB knockout mice. Developmental Cell 1:201-213. https:// doi.org/10.1016/S1534-5807(01)00025-9 Tian, B., Hu, J., Zhang, H., and Lutz, C.S. 2005. A large-scale analysis of mRNA polyadenylation of human and mouse genes. Nucleic Acids Research 33:201-212. https://doi. org/10.1093/nar/gki158 Tretyakova, I., Zolotukhin, A.S., Tan, W., Bear, J., Propst, F., Rothler, G., and Fleber, B. K. 2005. Nuclear export factor family protein participates in cytoplasmic mRNA trafficking. Journal of Biological Chemistry 280(36):31981-31990. https://doi.org/10.1074/jbc.M502736200 Tuck, A. C. and Tollervey, D. 2011. RNA in pieces. Trends in Genetics 27:422-432. https://doi.org/10.1016/j.tig.2011.06.001 Vacik, T. and Raska, I. 2017. Alternative intronic promoters in development and disease. Protoplasma 254:1201-1206. https://doi.org/10.1007/s00709-016-1071-y Voeltz, G.K. and Steitz, J.A. 1998. AUUUA sequences direct mRNA deadenylation uncoupled from decay during Xen-opus early development. Molecular and Cellular Biology 18:7537-7545. https://doi.org/10.1128/MCB.18.12.7537 Wallace, A. M., Dass, B., Ravnik, S. E., Tonk, V., Jenkins, N. A., Gilbert, D.J., Copeland, N.G., and MacDonald, C.C. 1999. Two distinct forms of the 64,000 Mr protein of the cleavage stimulation factor are expressed in mouse male germ cells. Proceeding of the National Academy of Science of USA 96:6763-6768. https://doi.org/10.1073/ pnas.96.12.6763 Wang, B., Rekosh, D., and Hammarskjold, M.-L. 2015. Evolutionary conservation of machinery for export and expression of mRNAs with retained introns. RNA 21:1-12. https://doi.org/10.1261/rna.048520.114
Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., Kingsmore, S. F., Schroth, G. P., and Burge, C. B. 2008. Alternative isoform regulation in human tissue transcriptomes. Nature 456:470-476. https://doi. org/10.1038/nature07509 Wells, S.E., Hillner, P.E., Vale, R.D., and Sachs, A.B. 1998. Circularization of mRNA by eukaryotic translation initiation factors. Molecular Cell 2:135-140. https://doi. org/10.1016/S1097-2765(00)80122-7 White, E.J. F., Brewer, G., and Wilson, G.M. 2013. Post-transcriptional control of gene expression by AUF1: Mechanisms, physiological targets, and regulation. Bio-chimica et Biophysica Acta 1829:680-688. https://doi. org/10.1016/j.bbagrm.2012.12.002 Xu, M., Gonzalez-Hurtado, E., and Martinez, E. 2016. Core promoter-specific gene regulation: TATA box selectiv-
ity and Initiator-dependent bi-directionality of serum response factor activated transcription. Biochimica et Biophysica Acta 1859:553-563. https://doi.org/10.1016/j. bbagrm.2016.01.005 Yang, J., Bogert, H. P., Wang, P.J., Page, D. C., and Cullen B. R. 2001. Two Closely Related Human Nuclear Export Factors Utilize Entirely Distinct Export Pathways. Molecular Cell 8:397-406. https://doi.org/10.1016/S1097-2765(01)00303-3 Zhou, J., Pan, J., Eckardt, S., Leu, N.A., McLaughlin, K.J., and Wang, P.J. 2011. Nxf3 is expressed in Sertoli cells, but is dispensable for spermatogenesis. Molecular Reproduction and Development 78(4):241-249. https://doi. org/10.1002/mrd.21291
