CC BY
47
category of patients. In our observations 46 patients (80,7%) had good results, 10 (17,5%) satisfactory and 1 patient (1,8%) had a poor result.
Follow-up results were considered good if there were no complaints after surgery. These patients had a satisfactory general state and functional parameters of the colon. No relapse of the disease was noted. The working capacity was restored.
Results were considered unsatisfactory in cases when constipation with manifestations of a chronic intestinal obstruction, which required a repeated intervention.
Thus, the problem of Hirschsprung's disease in adults is urgent and its solution can be provided by development of adequate tac-
tics of treatment including a surgical one with the use of modern methods of study.
Conclusion
1. To specify a diagnosis, radiological, endoscopic and functional studies of the colon should be supplemented by transanal biopsy of the rectal wall which is the most reliable method of diagnostics in Hirschsprung's disease in adults.
2. Performance of peritoneal-anal resection of the rectum with pulling through of functioning proximal parts of the large intestine into anal canal simplifies technique of operation at Hirschprung's disease and in the greater degree meet the requirement of radicalism, than method of Duhamel.
References:
1. Alagumuthu M., Jagdish S., Kadambari D. Hirschsprung's disease in adults presenting as sigmoid volvulus: a report of three cases.//Trop. Gastroenterol. - 2011. - Vol. 32, № 4. - P. 341-343.
2. Amiel J., Lyonnet S. Hirschsprung's disease, associated syndromes, and genetics: a review. J. Med.Gen. 2001; 38:729-739.
3. Borrego S., Ruiz-Ferrer M., Anticolo G. Hirschsprung's disease as a model of complex genetic etiology//Histol. Histopathol. - 2013. -Vol. 19, № 2. - P. 345-345.
4. Butler N. E., Trainor P. A. The developmental etiology and pathogenesis of Hirschsprung disease//Transl. Res. - 2013. - Vol. 22, № 6. -P. 123-178.
5. Hayes C. E., Kawatu D., Mangray S., Leiko N. S. Rectal suction biopsy to exclude the diagnosis of Hirschsprung disease//J. Pediatr. Gastroenterol. Nutr. - 2012. - Vol. 55, № 3. - P. 268-271.
6. Mahajan J. K., Rathod K. K., Bawa M., Narasimhan K. L. Transanal Swenson's operation for rectosigmoid Hirschsprung's dis-ease//Afr. J. Paediatr. Surg. - 2011. - Vol. 8, № 3. - P. 301-305.
Muminova Sevara Rustamovna, Mavlyanova Shakhnoza Zakirovna, Boboev Kodir,
Republican Specialized scientific-practical medical Centre of Dermatology and Venereology of the Health Ministry of the Republic of Uzbekistan, Tashkent E-mail: [email protected]
Molecular-genetic aspects of atopic dermatitis
Abstract: There was conducted work on optimization of test systems for the detection of polymorphisms -590S> T of IL4 gene in patients with atopic dermatitis and healthy donors. There was examined the contribution of this marker in the development (progression) of atopic dermatitis. It was revealed that the carriage of hetero + homozygous genotype observed in more than 3.0 times more frequent in patients with AtD than in conditionally healthy donors. At the same time, the calculated odds ratio also showed a significant increase of AtD progression risk in carriers of these combinations of genotypes (X 2=3.85; P=0.02; 0R=3.0; 95%CI 0.98-9.14).
Keywords: allergic dermatitis, atopy, IL-4 gene, DNA, polymorphism 590C> T.
Atopic dermatitis (AtD) — one of the most common and severe multifactorial diseases, which is being the result of an allergic reaction ofbody, and caused by the complex interaction of immunocompetent cells and transmitters. A special role in the pathogenesis ofAtD takes interleukine 4 (IL-4), since it is the initiator of molecular and cellular events leading to the release of neurotransmitters and migration of effector cells in "shock" organ (skin area, bronchus, nasopharynx, etc.), where expands the inflammatory response. In 1994, Marsh together with co-author proved correlation between IgE level of general serumal and markers located at the locus 5q31.1 [4]. Rossenwasser L. J. together with co-author (1995) revealed for the US population the transitions of cytosine to thymine (590S> 7) in promoter region of IL4 gene and showed this association of polymorphic variant with atopy and levels of general IgE, as well as gene overexpression of the gene in vitro [8]. Nowadays, some
research groups have published the results ofwhole genome linkage analysis under atopic conditions in different populations. However, these results are very contradictory and do not give an unambiguous answer to the question of the pathogenetic role and degree of participation of certain marker in formation of atopic diseases, including blood pressure [2; 3; 6; 9; 11].
Objective: To optimize the performance of oligoprimer's systems for testing 590C> T polymorphism of IL-4 gene and examining the contribution of this marker in the development of AD.
Materials and Methods: The materials for this study were taken the samples of DNA isolated from the peripheral blood of patients with AtD and conditionally healthy donors — individuals without any signs of atopic diseases. The total number of studied C and T alleles was 114 (70 chromosomes of the patients and 44 chromosomes of healthy individuals).
Section 6. Medical science
DNA isolation was performed on standard methods with some modifications. The reagents and enzymes were purchased from the world leading companies («Serva», «Sigma», etc.), and of Russia Federation («DNA technology», «SibEnzyme» etc.). The amplification of polymorphic loci was performed using polymerase chain reaction on a programmable thermal cycler of «Applied Biosysteems» company, (USA). Specificity of the synthesized fragment and the number of the amplificate was checked by electrophoresis method on 2% agarose gel and then was conducted hydrolyzing of resulting fragment using a restriction enzyme — Avail. Restriction of PCR product was carried out under + 37 °C for 12 hours, as indicated in the manufacturer's recommendations. The products of DNA fragments amplification and complete restriction were separated in 2-3% agarose gel and were assessed after staining with ethidium bromide in passing UV light.
Statistical analysis of findings was performed by using statistical software package of «OpenEpi 2009, Version 2.3». The frequency
of options of alleles and genotypes (f was calculated using the formula:
f = n/2N h f = n/N
where
n — the occurrence of variant/option (allele or genotype),
N — sample size.
Findings and Discussion: The initial stage of our work was the selection and synthesis of oligoprimer to reveal (590C> T) polymorphism of IL-4 gene. The Synthesis of oligoprimers was done on the base of the Federal Center of Medical Genetics Research Institute of Obstetrics and Gynecology, RAMS (Head. Member. Correspondent of RAMS. Professor Baranov V.S), with consulting aid of senior researcher PhD, Aseev M. V. The Information about gene pathways and structure of the primer was prepared taking into account the original literature [5] and in GeneBank. Characteristics of genetic marker and pathways of the synthesized oligoprimers are shown in Table 1.
Table 1. - Consecution of oligonucleotide primers used for PCR conducting
Gene, localization Polymorphism Structure of used oligoprimer Allele variants after restriction
Il-4 5q31 590C>T TAAACTTGGGAGAACATGGT TGGGGAAA-GATAGAGTAATA 590C (177+18bp) 590T (I95bp)
In the result of study we were able to optimize the temperature mode of oligoprimers operation under the following conditions: 1 cycle 95 °C-5min
{95 oC-30sec 50 oC-50sec 72 °C-30sec Elongation 72 °C-5min
Interpretation of received results are shown in Table. 1 and Fig. 1. Apparently, as a result of the PCR analysis the 590T mutant allele marker synthesized as a fragment of 195 b.p size. After restriction in patients with normal genotype of 590S generates fragments of 177+ 18b. p., but there is no fragment of 195 bp, while all three fragments (195 bp and 177 bp + 18) were amplified in heterozygous carriers.
Fig. 1. PCR Electrophoregram — 590C>T polymorphism products of IL-4 gene
+ K -Control; 1 and 3 - normal genotypes; 2 - heterozygous genotype; 4 - homozygous mutant genotype, M - a marker that determines
the size of PCR fragments.
Allele (allelomorph) 18 bp exceeds the bounds of the gel, due to its small size of the fragment.
In order to analyze the distribution frequency of the alleles and -590>T polymorphic variants of genotypes ofthe IL4 gene among the combined samples of AtD patients and the control group, the approbation of that system was conducted (Table 2).
In analyzing of the distribution frequency of alleles and -590>T polymorphism genotypes of the IL4 gene, it was found a significant prevalence of the mutant allele -590T in the AtD patients rather than in a group of conditionally healthy donors.
A mutant-type allele- 590T was found in 29 cases out of 70 (41.4%) and in 11 cases out of22 (25.0%) among studied main and control group. In this groups the frequency of the wild-type allele
of 590C, was found in 41 cases out of 70 (58.6%) and in 33 cases out of44 (75.0%).
At the same time, the calculated probability of the AtD (OR) disease risk in this polymorphism carriers was 2.1 times greater than in the carriers of the wild allele of 590C. These data is statistically significant (X2 = 3.2, P = 0.03; OR = 2.1; 95% CI 0.9 4.9).
Comparative analysis of the distribution of genotypes showed that the proportion of people with hetero- + homozygous mutant genotype of «C/T and TT» among patients and healthy donors was 25 out of 35 (71.4%) versus 10 out of22 (45.5%), respectively. The calculated probability of progression of AtD among carriers of these genotypes is truly higher in more than 3 times comparatively with the control group (X2=3.85; P=0.02; 0R=3.0; 95%CI 0.98-
9.14). Significant predominance of the number of mutant alleles of pathogenetic connection, ie, the association between 590C> T and genotypes carriers in patients group may indicate an availability polymorphism of IL4 gene and the formation of AtD.
Table 2. - Allele frequencies and 590C> T polymorphism genotypes distribution of IL 4 gene among AtD patients and the control group
Group n (X) Alleles frequency Genotyi pes distribution frequency
590 C 590 T C/C C/T T/T
n % n % n % N % n %
Main group 35 (70) 41 58.6 29 41.4 10 28.6 21 60.0 4 11.4
Control group 22 (44) 33 75.0 11 25.0 12 54.5 9 41.0 1 4.5
Note: X and n- number of chromosomes and persons studied, respectively.
It is necessary to emphasize that when comparing C/C genotype ofpatients having atopic dermatitis with the healthy one, there was found more than 4-fold valid frequency reduction of healthy genotypes occurrence (OR = 0.47; 95% CI 0.205-1.08). These data confirm the validity of our results, showing that IL4-590C allele is a marker of reduced risk of atopic dermatitis patients.
Thus, as a result of the study of 590C> T polymorphism of IL4 gene revealed that the DNA locus is associated with atopic dermatitis in Uzbekistan. This may be explained by the fact that polymorph substitution from C to T at position -590 leads to formation of the new site of factors transcription binding and to increased IL4 gene transcription [1; 8], the product ofwhich is a key cytokine in development of allergic inflammation.
Our findings are consistent with the results of foreign researchers regarding the populations of Russian, Japanese, English (residing in the south of the UK) and Americans of European origin [1; 2; 5; 12], where was found the association of 590C> T allele of IL4 gene with the progression of diseases related to atopy.
However, it should be emphasized that a number of other studies carried out in Australia and later in Italy, this association was not found [7; 10].
Summarizing the results, we can conclude that, in order to finally assess the contribution of genetic factors to the progression of atopic diseases in the future it would be interesting to extend the range of the studied candidate genes, especially genes of cytokines, the results of which will be another step in the creation of a genetic cascade and identifying among them a key genetic marker of AtD formation.
Conclusions:
1. As a result of the research work we have managed to create and successfully test a test system for the detection of polymorphisms -590S> T of IL4 gene.
2. The frequency of590C> T polymorphism occurrence of IL-4 gene in patients with AtD was significantly higher than that in the control group, indicating a significant association between the development of the disease and this genetic marker.
References:
1. Beghe B., Barton S., Rorke S., Peng Q., Sayers I., Gaunt T., Keith T. P., Clough J. B., Holgate ST., Holloway J. W. Polymorphisms in the interleukin-4 and interleukin-4 receptor a chain genes confer susceptibility to asthma andatopy in a Caucasian populations//Clin Exp Allergy. 2003, V.33. P. 1111-1117.
2. Khusnutdinova E. K., Karunas A. S., Fedorova U. U., Gilyazova I. R. Association of candidate genes polymorphism with asthma in Bashkortostan Republic of Russia//In: Molecular Polymorphism of Man. Ed.: S. D. Varfolomyev, G. E. Zaikov. Moscow. 2009. P. 540-582.
3. Kim SH, Lee CE. Counter-regulation mechanism of IL-4 and IFN-a signal transduction through cytosolic retention of the pY-STAT6: pY-STAT2: p48 complex//Eur.J. Immunol. 2011 Feb. 41 (2). P. 461-72.
4. Marsh D. G., Neely J. D., Breazeale D. R., Ghosh B., Freidhoff L. R., Ehrlich-Kautzky E., Schou C, Krishnaswamy G., Beaty T. H. Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations//Science. 1994. V.264. P. 1152-1156.
5. Noguchi E., Shibasaki M., Arinami T. et al. Lack of association of atopy/asthma and the interleukin-4 receptor a gene in Japanese//Clin. Exptl. Allergy. 1999. V. 29. P. 228-233.
6. Ober C., Hoffjan S. Asthma genetics 2006: the long and winding road to gene discovery//Genes Immun. 2006. Vol. 7. № 2. P. 95-100.
7. Rigoli L., Di Bella C, Procopio V., Barberio G., Barberi I., Caminiti L., La Grutta S., Briuglia S., Salpietro CD., Pajno G. B. Molecular analysis of sequence variants in the Fcepsilon receptor I beta gene and IL-4 gene promoter in Italian atopic families//Allergy. 2004. V.59. P. 213-218.
8. Rosenwasser L. J., Klemm D. J., Dresback J. K., Inamura H., Mascali J. J., Klinnert M., Borish L. Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy//Clin. Exp. Allergy. 1995. V. 25. P. 74-78.
9. Scirica C. V., Celedon J. C. Genetics of asthma: potential implications for reducing asthma disparities//Chest. 2007. Vol.132. P. 770-781.
10. Walley A. J., Cookson W. O. Investigation of an interleukin-4 promoter polymorphism for associations with asthma and atopy//J. Med. Genet. 1996. V.33. P. 689-692.
11. Weiss S. T., Raby B. A., Rogers A. Asthma genetics and genomics 2009//Curr Opin Genet Dev. 2009. Vol.19. № 3. P. 279-282.
12. Yoshihiko Chiba, Kumiko Goto, Makiko Momata, Taiki Kobayashi and Miwa Misawa. Induction of RhoA gene expression by interleukin-4 in cultured human bronchial smooth muscle cells//J. Smooth Muscle Res. 2010. Vol. 46. P. 217-224.
