CC BY
71Russian Journal of Nematology, 2015, 23 (1), 1 - 20
Molecular and morphological characterisation of Meloidogyne hapla populations from Ethiopia
13 2 3
Beira-Hailu Meressa ' , Holger Heuer , Heinz-Wilhelm Dehne and
Johannes Hallmann1
1 Julius Kühn-Institut, Federal Research Center for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics,
Toppheideweg 88, D-48161, Münster, Germany 2 Federal Research Center for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Messeweg 11-12,
D-38104, Braunschweig, Germany 3 Institute for Crop Science and Resource Conservation (INRES), Department of Phytomedicine, University of Bonn,
Meckenheimer Allee 166a, D-53115, Bonn, Germany e-mail: [email protected]
Accepted for publication 24 January 2015
Summary. Meloidogyne hapla, considered mainly a temperate species, was recently detected parasitising rose plants in glasshouses in Ethiopia. Roses are grown in more than 80% of the existing cut-flower producing farms in Ethiopia. Nevertheless, its production is increasingly facing serious nematode problems. Consequently, soil samples were collected from 12 randomly selected farms distributed in six districts around Addis Ababa. Nine of these farms were positive for Meloidogyne spp. and six were positive for M. hapla. Pure isolates of 125 Meloidogyne spp. from the latter six farms were established from single egg masses on tomato cv. Moneymaker. Based on molecular and morphological data, eighty-two of the isolates were identified as M. hapla. Morphological characters based on light and scanning electron microscope images together with morphometric measurements of females, males and second-stage juveniles (J2) were compared with populations of M. hapla from different countries. In addition, molecular characterisation was performed based on the 28S D2-D3 expansion segments within the ribosomal DNA and the region located between cytochrome oxidase unit II and the 16S rRNA gene of the mitochondria (mtDNA). Morphological characters of females, males and J2 were in line with descriptions of other M. hapla populations but there were a few exceptions in morphometric measurements. The female perennial pattern of the Ethiopian populations fitted the original description but was smaller than that of the population described by Jepson. The J2 body size was larger compared to previous descriptions from Hawaii and East Africa and the a ratio value was much greater than for the East African population but similar to the Hawaiian population. Phylogenetic relationships of the Ethiopian M. hapla population with other related Meloidogyne species on the bases of both mtDNA and D2-D3 expansion segment sequence analysis revealed highly supported clades containing the Ethiopian isolates as well as other published isolates from different countries.
Key words: cut-flowers, glasshouse, molecular diagnostics, mtDNA, phylogeny, rDNA, roses.
Root-knot nematodes (Meloidogyne spp.) are endoparasites that are spread worldwide causing severe damage on many economically important crops. They are a problem particularly on glasshouse cultivated crops including ornamentals (Nagesh & Reddy, 2005). Currently, the genus comprises more than 90 species (Hunt et al, 2005). Of these, the three tropical species Meloidogyne javanica, M. arenaria and M. incognita have been previously reported from open fields in Ethiopia (O'Bannon, 1975). These species are responsible for most nematode damage on most agricultural crops
in the tropics (De Waele & Elsen, 2007). Information regarding nematode problems in glasshouses in Ethiopia is almost non-existent. Nevertheless, cut-flower growers in Ethiopia repeatedly reported plant damages most likely caused by plant-parasitic nematodes, but this was never followed-up. A survey conducted in cut-flower producing glasshouses in 2011 and 2012 revealed the occurrence and wide distribution of several major plant-parasitic nematodes (Meressa et al, 2011). This survey indicated among others increased densities of root-knot nematodes with M.
hapla usually being the prominent species. Regardless of management strategies, accurate species identification is crucial before any control measures can be started. Hence, the use of both morphological and molecular analysis is important for reliable diagnostics of the species (Orui, 1988; Zijlstra et al, 2000; Blok et al, 2002; De Luca et al, 2011; Birithia et al, 2012; Onkendi & Moleleki, 2013). Furthermore, since we detected M. hapla only recently in Ethiopia, a comparison of the Ethiopian M. hapla population with M. hapla populations from other regions was done to see if the general characteristics of this species were met or if there were differences. This should facilitate future diagnostics and control programmes.
Consequently, the objectives of this study were: i) to characterise the Ethiopian M. hapla population based on morphological and molecular data; ii) to compare the Ethiopian isolates of different localities and with populations from other countries based on morphology and morphometry; and iii) to reconstruct phylogenetic relationships with M. hapla populations of different geographical origin and otherMeloidogyne species.
MATERIALS AND METHODS
Nematode isolates and pure culturing. During a survey in 2011 soil samples were collected from glasshouses randomly selected from 12 farms distributed in six districts around Addis Ababa, Ethiopia. Meloidogyne spp. were detected on nine farms and M. hapla on six farms. For the latter a list of the farm code and locality is given in Table 1. Pure nematode cultures of Meloidogyne spp. were established for further analysis at Julius Kuehn Institute, Germany. In this case, nematodes were first propagated on roses (Rosa corymbifera cv. Laxa) as their original host and then on tomato cv. Moneymaker. All propagation was done in the glasshouse at 20 ± 3°C and 14 h photoperiod.
For each population (hereafter each population represents one farm) 20-60 egg masses were randomly handpicked. Individual egg masses were then placed in 1.5 ml distilled water into wells of a 24 well cell culture plate (Greiner Cellstar®, Frickenhausen, Germany) and kept at room temperature to stimulate hatch of second-stage juveniles (J2). Egg masses from which more than 50 J2 hatched within 3 days received a farm code followed by consecutive isolate number. Hence, each of the six farms was represented by 7 to 51 isolates making a total of 125 isolates. J2 suspensions from each well were then individually pipetted with a micropipette (Eppendorf GmbH,
Hamburg, Germany) and injected into holes made around the stem of 2 week-old tomato seedlings grown in 100 ml pots filled with a mix of steam sterilised field soil and silver sand (1:1, v:v).
Seventy-five days later, six egg masses per isolate were handpicked with forceps from each tomato root system under a stereomicroscope and placed in 1.5 ml double deionised water into wells of a 24 well cell culture plate to stimulate J2 hatch. Hatched J2 were then pipetted into 1.5 ml Eppendorf tubes and stored at 4°C until needed for DNA extraction.
Morphometric and morphological analysis.
Nine randomly selected M. hapla isolates viz. STRB6, FYRB60, FYRB62, ETDB47, FLMB18, GUNB26, HRBB82, HRBB100 and HRBB107 representing the different farms (populations) and regions were randomly selected for morphological and morphometrical studies. Males and J2 were killed with gentile heat, fixed in a solution containing 7 ml formalin (40% formaldehyde), 2 ml triethanolamine and 91 ml distilled water (Courtney et al, 1955) and processed to anhydrous glycerol over a period of 12 days through slow evaporation technique at 38-40°C (Hooper, 1970). Permanent slide mounts were then made after transferring the nematodes into anhydrous glycerol following the method described by Hooper et al. (2005).
For females, perineal patterns were prepared from eight individuals per isolate. Each female was handpicked from galled roots under a stereomicroscope and placed in a drop of water sitting on a microscope slide. The posterior end was cut off with a surgical blade and transferred to 45% lactic acid for 25 min before the inner surface was gently cleaned using a curved fine needle. The cuticle with the perineal pattern was then carefully trimmed. For each isolate, four perineal patterns were transferred to a drop of glycerin for permanent slide mounts. In addition, intact females were prepared for morphometric measurements. Therefore, galled roots were fixed in 3% formaldehyde for 48 h. At least eight females per isolate were handpicked from the root galls and transferred to a drop of water to make temporary slide mounts.
For light microscopy, all specimens were examined under a Leitz Diaplan compound microscope (Leitz, Wetzlar, Germany) at 630-1000 x magnification. Morphometric measurements were recorded from digital images taken with Leica DC 180 camera equipped to the microscope and analysed with Leica IM500 image measurement software (Leica Microsystems AG, Wetzlar, Germany). Light microscopic images were taken
with the same camera. All measurements were in micrometers (^m) unless otherwise specified. All morphometric data were subjected to analysis of variance (ANOVA) using SPSS version 20 (SPSS, Inc., Chicago IL, USA). Tukey's HSD (Honest Significant Difference) test was used to compare the means at the 0.05 level.
Nematodes of isolate HRBB100 were processed for scanning electron microscopy (SEM). Specimens were fixed in Trump's fixative and dehydrated in a graded ethanol series, critical point dried (Balzers Union CPD 020, Bal-Tec AG, Balzers, Liechtenstein), mounted on stubs, sputter-coated with gold (Balzers Union SCD 040, Bal-Tec AG, Balzers, Liechtenstein) and examined with a Jeol JSM-840 SEM (Jeol Ltd., Tokyo, Japan).
Molecular analysis. DNA extraction and purification. Total DNA was extracted from the 125 isolates of root-knot nematode in which each farm was represented by varying numbers of isolates viz. STR = 7, FYR = 18, ETD = 13, FLM = 18, GUN = 18 and HRB = 51. Nematode suspensions of 100 ^l were pipetted onto a cover slip under a stereomicroscope. A minimum of 25 J2 were then handpicked into 10 ^l double deionized water in 0.2 ml Eppendorf microtubes. The tubes were then centrifuged for 5 s to get nematodes fully covered with water. For DNA extraction, tubes were left open overnight to let the water evaporate. Next, 10 ^l worm lysis buffer (500 mM KCl, 100 mM Tris-HCl pH 8.2, 15 mM MgCl2.6H2O, 10 mM dithiothreitol (DTT); 4.5% Tween-20) and 2 ^l 20 mg ml-1 Proteinase K was added. Sterilised tooth sticks were used to crush the nematodes and mix the lysate gently. The lysate was then frozen at -80°C for 20 min and incubated at 63°C for 1 h followed by 95°C for 15 min to stop the activity of Proteinase K.
Total DNA was precipitated from the final aqueous phase by addition of 40 ^l isopropanol that was pre-cooled to -20°C, followed by centrifugation at 13,200 g for 30 min at 4°C. The DNA was then washed by centrifugation at 13,200 g for 15 min with 30 ^l of 70% ethanol, air-dried and re-suspended in 35 ^l of 1x TE buffer (10 mM Tris and 1 mM EDTA at pH 8).
PCR assay. The first primer set used here was as described by Powers & Harris (1993). Primers C2F3 (5' -GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5 '-TACCTTTGACCAATCACGCT-3') amplify the region between the mitochondrial cytochrome oxidase subunit II gene and the large (16S) ribosomal gene. The other set of primers D2A (5' -AC AAGTACCGTGAGGGAAAGTT-3') and D3B (5'-TCGGAAGGAACCAGCTACTA-3') used was to amplify the D2-D3 expansion region of the
28S rRNA gene (Baldwin et al., 1997). All primers were supplied by Eurofins Genomics, Ebersberg, Germany. The overall PCR mix (25 |l) contained 3 |il DNA template, 0.2 mM dNTPs, 1 |il 10 ^M each primer, 2.5 il 10x Dream TaqTM buffer and 1 U of Dream TaqTM DNA polymerase (Fisher Scientific Inc., Schwerte, Germany). The COII-16S PCR reaction was set for heating at 94°C for 3 min followed by 35 cycles of amplification at 94°C for 2 min, 54°C for 90 s, and 72°C for 1 min with a final incubation for 5 min at 72°C. For the D2-D3 region, all conditions were the same as above except that the annealing temperature was 56°C and the timing for the extension phase was extended to 2 min. All PCR reactions were run in Applied Biosystem® 2720 Thermal cycler (Applied Biosystems, Foster City, CA, USA). The amplified products were separated on 1.0% agarose gels in 1* TBE buffer at 5 V cm-1 for 1 h, stained with 0.0001% ethidium bromide, and visualised at UV-light (Bio-Rad Laboratories GmbH, Munich, Germany).
Cloning and sequencing. The PCR products of both genes amplified by using COII-16S and D2-D3 primer sets were sequenced directly and one isolate per farm was sequenced from cloned products for confirmation. Prior to sequencing or cloning, PCR products were purified using the Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's instruction for PCR-product purification. For direct sequencing, 5 ^l of the PCR products and 5 ^l of 10 pmole ^l"1 of the respective forward primers were mixed. PCR products were cloned into pGEM®-T Easy vector (Promega GmbH, Mannheim, Germany). JM109 high efficiency competent Escherichia coli cells were used for transformation of the ligation product. Plasmid DNA from the bacteria culture was purified using PureYieldTM Plasmid Miniprep System (Promega GmbH, Mannheim, Germany). At least two representative isolates from each rose farm were randomly selected for sequencing in one direction. Sequencing was performed at the Macrogene sequencing facility service (Amsterdam, The Netherlands).
Phylogenetic analysis. Newly obtained sequences of both mtDNA (COII-16S) and D2-D3 expansion segment of 28S rRNA genes plus related published sequences from GenBank were used to reconstruct the phylogenetic trees. Bursaphlenchus xylophilus (JQ423203) for mtDNA (COII-16S) and B. africanus (HM623784) for D2-D3 was chosen as outgroup taxa. Raw sequences obtained were first proofread in Chromas Lite version 2.1 (2012) (Technelysium Pty Ltd., South Brisbane, Queensland, Australia) to remove ambiguous base
sequences before subjected to BLAST engine (Altschul et al., 1990) for sequence similarity search in GenBank NCBI database. All sequences from the GenBank (Table 2) and the new sequences obtained were aligned using ClustalX version 2.0 (Larkin et al., 2007) with default parameters. All sequences were trimmed to equal length using alignment editor in MEGA5 (Tamura et al., 2011).
Pairwise distance between M. hapla isolates from Ethiopia and isolates from The Netherlands (PPSC3093; DQ145641), Germany (JKI-de) and sequences in GenBank from China (JN005873; GQ130139) and Moldova (DQ328685) of D2-D3 sequences was analysed by MEGA5 (Tamura et al., 2011).
The variability in nucleotide position was compared. Sequences of six selected isolates were aligned using ClustalX version 2.1. The alignment
was then manually edited by GeneDoc multiple sequence alignment editor (Nicholas et al, 1997) in which the sequences were trimmed to equal length.
The phylogenetic analysis was carried out with Maximum Likelihood (ML) and Maximum Parsimony (MP). ML analysis was performed using heuristics searches with Nearest-Neighbour-Interchange (NNI) branch swapping filter. The MP analysis was performed using heuristics searches with Tree-Bisection-Reconnection (TBR) with random addition of 10 sequence replicates. The support for each branch was estimated using the bootstrap (bs) method with heuristics search and 1000 replicates in both ML and MP analysis in MEGA5 (Tamura et al, 2011). Values of the relative base frequencies, gamma distribution shape parameter, and base substitution rates were also estimated in MEGA5.
Fig. 1. Light micrographs of Meloidogyne hapla isolates. A: female anterior body part; B: perineal pattern; C: male tail and spicule; D: second-stage juvenile (J2) tail types; E & F: anterior part of J2 and male to isolate HRBB100.
RESULTS
Morphology and morphometric analysis. Comparisons between Ethiopian isolates.
Meloidogyne hapla from Ethiopia was determined by morphological and morphometrical analysis of
females, males and juveniles (Figs 1 & 2; Tables 3 & 4). The perineal pattern had generally an ovoidal shape with fine striae forming a wavy pattern on one side. Subcuticular punctuation round the tail terminus appeared from more dispersed to well concentrate manner (Figs 1B, 2G & H). The male had apparent setoff head region and setoff rounded
Table 1. Meloidogyne hapla isolates used for molecular analysis in this study
Locality Altitude m a.s.l Farm code Isolate code Accession
mtDNA (COII) 28S D2-D3
Holleta 2300 STR STRB4 KP681271 KP640618
STRB6 KP681272 KP410843
FYR FYRB60 KP681257 KP410850
FYRB66 KP681259 KP410851
FYRB67 KP681260 KP410840
ETD ETDB44 KP681252 KP410854
ETDB47 KP681253 KP410836
ETDN54 KP681254 KP410845
Menagesha 2300 FLM FLMB18 KP681255 KP410841
FLMB24 KP681256 KP410848
Sebeta 2100 GUN GUNB26 KP681261 KP410838
GUNB42 KP681258 KP410853
Ziway 1600 HRB HRBB82 KP681263 KP410842
HRBB95 KP681264 KP410844
HRBB98 KP681265 KP410849
HRBB100 KP681266 KP410852
HRBB103 KP681267 KP410855
HRBB107 KP681262 KP410846
HRBB112 KP681268 KP410837
HRBB115 KP681269 KP410835
Germany unknown JKI JKI-de KP681270 KP410839
The Netherlands unknown PPS PPSC3093-nl - KP410847
but with varying size of stylet knob (Figs 1F, 2A & B) and tail shape (Figs 2D & E). In J2, most qualitative characters were similar to previous descriptions (Jepson, 1987) (Figs 1E & 2I-M) with various tail shapes. In both male and J2 lateral lines were four in number (Figs 1D & 2K).
Morphometrics for females and J2 of nine selected Ethiopian isolates representing six farms are presented in Table 3 and 4. Comparisons of morphometrics revealed intra-population variations in some characters. Female body length (P = 0.001), stylet length (P = 0.04), distance between DGO and stylet base (P = 0.01) varied significantly within the Ethiopian isolates. Isolate ETD47 showed the
greatest body length (706.9 ^m) of all the isolates but on the other hand had the shortest DGO length from stylet base (4.1 ^m). By contrast, isolate HRBB100 had the smallest body length (528.6 ^m) but the greatest DGO length from the stylet base (5.2 ^m).
Second-stage juveniles showed significant differences in body length (P < 0.001), head height (P = 0.03), centre of median bulb from anterior end (P < 0.001), stylet length (P = 0.01), distance of DGO from stylet base (P = 0.002), tail length (P = 0.02), tail width at hyaline portion (P = 0.01), a ratio (P < 0.01) and caudal ratio A (P = 0.01). Isolate STRB6 from the highland region had a lower
average body length, centre of median bulb from anterior end, excretory pore to anterior end, DGO from base of stylet and tail length than the rest of the isolates. By contrast, HRBB107 of the lowland region
The Ethiopian isolates were primarily collected from localities at altitudes ranging from 1600-2500 m a.s.l. having varying mean annual precipitation and temperatures. However, lack of consistency for variation within the isolates from the same farm may suggest that the difference seen between isolates is not strong enough to be due to the influence of geographical factors.
Comparison between Ethiopian and other populations. For comparison of M. hapla from Ethiopia with populations from other countries all Ethiopian, M. hapla isolates were considered to be
had the greatest average body length, centre of median bulb from anterior end, excretory pore to anterior end, DGO from base of stylet, tail length and a ratio of all isolates.
of the same origin and therefore were pooled to form the so-called Ethiopian population of M. hapla. The Ethiopian population was then compared in terms of morphometric characters with populations described from Hawaii (Handoo et al., 2005), East Africa (Whitehead, 1968), and those mentioned in Jepson (1987) and Chitwood (1949) (Tables 5 & 6). In general, most morphometrics of the Ethiopian population of M. hapla fitted closely within the range of the beforehand mentioned populations, but some exceptions.
Table 2. GenBank accession numbers for reference sequences used for phylogenetic analysis
Nematode species COII-16S of mtDNA Reference and origin (country) 28S D2-D3 Reference and origin (country)
M. arenaria FJ159610 Fargette et al., 2010; Australia KF112873 Zeng & Huang, 2013; China
- - AF435803 De Ley et al, 2001; USA
M. chitwoodi - - JN019321 McClure et al, 2011; USA
M. ethiopica AY942848 Tigano et al., 2006; Brazil KF482372 Carneiro et al., 2013; Brazil
JN673275 Maleita et al, 2012; Portugal - -
M. enterolobii - - JN005866 Hu et al., 2011; China
KJ146862 Wang et al., 2014; China
M. graminis - - JN019339, JN157849 McClure et al, 2012; USA
M. hapla AY539839 Handoo et al., 2005; Hawaii DQ145641 Nadler et al, 2006; The Netherlands
FJ159608 Fargette et al., 2010; Australia DQ328685 Subbotin et al, 2005; Moldova
AY757902, AY757903, AY757889, Y757887, AY757901, AY757899 Powers et al, 2005; USA JN005873 Hu et al, 2011; China
L76262 Hugall et al, 1997; Australia GQ130139 Wang et.al., 2009; China
AY757900 Powers et al, 2005; USA KJ755183 Lio & Zhang, 2004; China
AY942850 Tigano et al., 2006; Brazil KJ598136 Chen, 2014; China
M. hispanica JN673274 Maleita et al, 2012; Portugal EU443606 Landa et al., 2008; Spain
- - KF501128 Tzortzaka et al., 2013; Greece
M. incognita FJ159628 Fargette et al, 2008; Australia JX100424 Wu et al, 2012; Taiwan
KF482374 Carneiro et al., 2013; Brazil
M. javanica JX100439 Wu et al., 2012; Taiwan KC953092 Wang et al, 2013; China
JQ317912 Naz et al. ,2011; Pakistan
M. marylandi - - JN019363, JN019351 McClure et al, 2012; USA
M. partityla AY672412 Thomas et al, 2004; USA - -
AY757908 Powers et al, 2005; USA - -
M. thailandica - - EU364890 Skantar et al., 2007; USA
B. xylophilus JQ423194 Valadas et al., 2012; Portugal HM623784 Gu & Wang, 2010; China
Female body length (577.1 ^m vs 781 ^m) and width (410 ^m vs 492 ^m) of the Ethiopian population was smaller than that of the population described by Jepson (1987). The stylet length was similar for the Ethiopian population (14.6 ^m) and the population described by Jepson (14.6 ^m) but greater than the East African population (11 ^m). The inter phasmids distance of the Ethiopian population (20.2 ^m) was similar to the population from Hawaii (20.9 ^m) but smaller than that of the original description (24.4 ^m) by Chitwood (1949). In terms of length of vulva slit, the Ethiopian population (19 ^m) could be distinguished from the Hawaiian population (23.9 ^m).
The mean J2 body length and tail length was greater for the Ethiopian population (369.7 ^m; 47.9 ^m) than for the Hawaiian population (323.1 ^m; 42.6 ^m) and East African population (337 ^m; 43 ^m). The population described in Jepson (1987) had the greatest mean tail length (59 ^m) of all those populations. Moreover, both the East African and Hawaiian populations showed a lower a ratio (31 vs 23.9) and a shorter length of hyaline tail terminus (14 ^m vs 10.9 ^m), respectively, than the Ethiopian population.
Molecular analysis. Sequence analysis. The amplification of the mtDNA (COII-16S) and 28S D2-D3 expansion segment of the 28S rDNA region produced single fragments of about 540 bp and 740 bp, respectively. All tested 125 isolates of Meloidogyne spp. gave the same fragment size for the D2-D3 region, similar to the two M. hapla isolates form The Netherlands and the isolate from Germany. For mtDNA, only 82 of the 125 isolates yielded a PCR product size similar to the control of M. hapla from Germany. Out of the 82, twenty isolates were randomly selected and sequenced for both genes. A BLAST search at NCBI for both genes confirmed the species identity of the Ethiopian isolates (data not shown). For the mtDNA, each isolate revealed 99100% sequence identity with one or more previously published isolates ofM. hapla. For the D2-D3 region, 93-99% identity was obtained. Moreover, both sequence and phylogenetic analysis confirmed that the Ethiopian isolates represent M. hapla. Furthermore, when compared to other Meloidogyne species, the highest percentage identity obtained for mtDNA was 86% with M. partityla, whereas for D2-D3 region it was 89% with M. ethiopica.
Nucleotide characteristic. The final mtDNA sequence alignment contained 511 positions with 162 parsimony informative sites. Within the Ethiopian isolates, there were four groups based on A+T richness: 83%, 87%, 88% and 89%. The Ethiopian isolates shared an overall intra-sequence similarity value of 98.4%. The sequence similarity among all isolates of M. hapla sequences aligned in
the sequence analysed was 91-100%. For comparison, mtDNA sequence similarity with other Meloidogyne species ranged between 23% for M. partityla and 29% for M. javanica (data not shown).
Similarly, the ClustalX alignments for the D2-D3 region consisted of 762 nucleotide positions with 255 parsimony-informative. When the % AT was compared among the Ethiopian isolates, three types of AT richness were observed: 54%, 55% and 56%. Out of those, HRBB107 showed low % AT in both gene sequences.
Nucleotide position in D2-D3 sequence. The alignment for the 28S D2-D3 region was compared between three Ethiopian isolates (GUNB26, STRB6, FLMB24) and other isolates from Germany (JKI-de ), The Netherlands (PSSC3093) and GenBank (GQ130139; China) (Fig. 3). Overall, the alignment consists of six sequences with 683 bp in length (after trimming to equal length). A total of 61 variable positions were found among sequences of those six isolates. The variability is described as 16 transitions (11 G-—A; 5 C-—T); 43 transversions (8 A—C, 9 G-—T, 12 A—T and 14 G—C) and two indels — T/C. The highest nucleotide variation (45 nucleotides) was between The Netherland's isolate PSSC3093 and the Ethiopian isolate GUNB26. The other two Ethiopian isolates varied from PPSC3093 with 6 and 17 nucleotides for FLMB18 and STRB6, respectively. On the other hand, FLMB18 and STRB6 varied from GUNB26 with 39 and 28 nucleotides, respectively. FLMB18 and STRB6 differ from each other by 11 nucleotides and from the German isolate JKI-de with 5 and 6 nucleotides, respectively.
Sequence similarity of the D2-D3 region was compared between Ethiopian isolates, three other isolates from GenBank (DQ328685, JN005873 and GQ130139), one isolates from The Netherlands (PSSC3093) and one isolate from Germany (JKI-de). Results indicated that Ethiopian isolates vary in sequence homology between each other and isolates originating from other countries (Table 7). Isolate HRBB107 shared low similarity (83%) with isolate ETDB47, HRBB95 and JKI-de. The Isolate JKI-de from Germany shared a maximum of 99% similarity with five Ethiopian isolates. Isolates originated from The Netherlands (PPSC3093), Moldova (DQ328685) and China (JN005873, GQ130139) shared 100% similarity with six of Ethiopian isolates.
Phylogenetic analysis. The ML analysis from a total of 44 sequences for mtDNA and 38 sequences for D2-D3 were able to infer the phylogenetic relationship among the root-knot nematodes. Based on default parameters, the best sequence evolution model for mtDNA was found to be T92+G representing the model Tamura 3-parameter (Nei & Kumar, 2000). The base frequency varied in that
Table 3. Morphometries comparison of females of Ethiopian isolates of Meloidogyne hapla (n = 45)
Morphological character1 M. hapla isolates
HRBB100 HRBB107 FYRB60 FYRB62 HRBB82 ETDB47 FLMB18 GUNB26 STRB6
528.6 ± 42.4° 549.8 ±74.8bc 551 ± 40.8bc 596 ± 83.2bc 638.6 ± 54. lab 706.9 ± 101.3a 579.8 ± 99.2bc 520.2 ± 53c 523.1 ± 31.7C
Body length (486-574) (442-640) (512-605) (463.8-685.8) (582.5-704) (606-877.6) (482.8-718) (468-587) (481.6-551)
14.7 ± 0.9ab 16.1 ± 1.5a 14.7 ± 1.7ab 15.1 ±2.3ab 13.4 ± 0.5b 14.3 ± 1.2ab 13.5 ± 0.6b 14.7 ± lab 13.6 ± lb
Stylet length (13.8-16) (14-17.6) (13-17.4) (12.4-17.7) (12.8-14) (13.2-16.2) (12.9-14.2) (13.8-16.2) (12.8-15)
3.5 ± 0.5a 3±0.1c 3.2 ± 0.3abc 3.4 ± 0.4ab 3±0.1bc 3±0.1bc 3±0.1bc 3.1±0.3bc 2.9 ± 0.3°
Stylet knob width (3-4) (2.8-3.2) (3-3.6) (3-4.1) (3-3.2) (3-3.2) (3-3.2) (2.9-3.6) (2.5-3.2)
5.2 ± 0.4a 5.1 ± 0.2a 5.4 ± 0.6a 5.1 ± 0.2a 4.9 ± 0.2ab 4.1 ± 0.6° 4.8 ± 0.4ab 4.4 ± 0.5bc 5.4 ± 0.5a
DGO from stylet base (5-6) (4.8-5.4) (5-6.2) (5-5.4) (4.6-5) (3.4-5) (4.1-5) (4-5) (5-6)
33.4 ± 5.8) 31.4 ± 4.6 29.4 ± 5.2 34.2 ±3 30.4 ±4.4 34 ±4.4 33.5 ±5.8 30.8 ± 5.2 30.1 ±4.9
Excretory pore from anterior end (28-41) (26-37) (23-35) (31.4-38.4) (25-36) (29.7-41.3) (27-42) (26.3-39.4) (23-36.4)
21.3 ± 1.8 20.7 ±3.7 18.7 ± 1.2 21.8 ±2.2 20.6 ±3.1 19.3 ±2.5 18.6 ± 1.8 20.6 ± 1.3 20 ± 1.2
Distance between phasmids (20-24) (14.5-23.2) (17.4-20) (19.8-24.4) (18-26) (16.4-23) (16.8-21.6) (18.6-21.8) (18.6-21.6)
19 ±2 18.2 ± 1.6 18.9 ±0.4 20.2± 2.4 18.4 ±2.1 18 ± 3.7 19.9 ±2.5 19.2 ±0.6 18.8 ±0.4
Vulva slit length (17-22) (16-20) (18.4-19.2) (17.6-24) (16.3-21) (13-21) (16.8-23.7) (18.2-20) (18.4-19.2)
16.6 ± 1.3 15.6 ± 1.9 16.5 ± 1 17.6 ±3 15.8 ±0.6 16.4 ±2.1 18.6 ±3.4 16.1 ± 1.5 17.1 ± 1.3
Vulva-anus distance
(15-18.4) (14-18.4) (15.8-18.2) (14.8-22.4) (15-16.6) (14-19) (14.4-23.6) (13.6-17.6) (15-18.4)
18.9 ±3.3 16.5 ±2 15.3 ±2 17 ± 1.5 16.5 ± 1 16.5 ±2.7 17 ± 1.4 16.8 ± 1.1 16 ± 1.9
Distance from anus to tail terminus
(14.9-22.8) (13.3-18.6) (12.8-18.4) (14.6-18.4) (14.9-17.4) (13.8-20.8) (15.2-18.4) (15.2-18.4) (13.8-18.4)
'a' ratio 1.6±0.1 1.4 ±0.3 1.4 ± 0.1 1.4 ±0.2 1.5 ±0.3 1.6 ±0.2 1.4 ±0.1 1.3 ± 0.1 1.3 ±0.1
(1.4-1.7) (1.1-1.7) (1.2-1.6) (1.2-1.6) (1.2-1.9) (1.4-1.8) (1.3-1.5) (1.2-1.4) (1.1-1.4)
2.3 ±0.3 2 ±0.3 2 ±0.3 2.3 ±0.5 2.3 ±0.4 2.4 ±0.4 2.5 ±0.4 2.1± 0.5 2.2± 0.4
Excretory pore/stylet length (1.9-2.6) (1.6-2.3) (1.6-2.4) (1.8-2.7) (1.9-2.8) (1.8-2.9) (2.1-3.2) (1.6-2.9) (1.5-2.6)
1 Means in the same row followed by the same letter are not significantly different atP = 0.05, according to Tukey HSD Multiple comparison test.
Table 4. Morphometries comparison of second stage juvenile of Ethiopian isolates of Meloidogyne hapla (n = 45). All measurements are in |im as mean ± s.d. (range)
Morphological character1 M. hapla isolates
STRB6 FYRB62 FLMB18 HRBB82 HRBB100 FYRB60 HRBB107 ETDB47 GUNB26
Body length 335.8 ± 16.5d 373.24 ± 11. lbc 380.2 ± 18.8b 361.8 ± 17.3bc 360.7 ± 14.7bc 364.8 ± 9bb 407.4 ±6.8a 368.1 ± 8.2b 374.7 ±8.4C
(315-351) (355-385) (350-402) (340-380) (345-375.4) (352.7-378.1) (399-417) (354-373) (362.5-384.8)
2.1 ±0.1abc 1.96 ± 0.3bc 2.3 ± 0.4bc 2.1 ± 0.1abc 2.5 ± 0.2abc 1.76 ± 0.3ab 2.1 ± 0.3ab 2.1 ±0.1c 2.2 ± 0.5a
Head height (2-2.2) (1.4-2.2) (2-3) (2.0-2.3) (2.3-2.8) (1.4-2) (1.6-2.3) (2-2.2) (1.8-3)
Centre of median bulb from anterior 43.7±4.7tl 49.64 ±2.6C 52.3 ± 3.5a 49.8 ± 2.2bc 54.3 ± 2.1abc 53.1 ± 1.8abc 55 ± 2ab 52.3 ± 3abc 53.8 ± 3.1a
end (40-51) (45.6-52) (47.6-55.7) (46.4-52) (51.3-56.2) (51.2-55) (52-57) (48.8-57) (48.8-56.4)
63.2 iSJ11 70.76 ± 1.8° 76.88 ±2.5ab 71.6 ± l.lab 71.1 ± 2.1bc 75.3 ± 1.7ab 78.6 ± 3.7a 73.7 ± 3.9ab 75.5 ± 2.2°
Excretory pore to anterior end (60-68.8) (68.8-73) (74.8-79.8) (70.4-72.8) (68.8-74) (73.6-78) (76-84) (68.4-79.1) (73.2-79)
12.8 ± 0.3° 13.48 ± 0.7abc 13.4 ± 0.9ab 13.3 ± 0.5abc 12.9 ± 0.4° 14.2 ± 0.4abc 14.2 ± 0.4a 12.7 ± 1.7° 13.9 ± 0.2bc
Stylet length (12.4-13) (12.8-14.4) (12-14) (12.8-14) (12.2-13.3) (14-15) (14-15) (10.4-14) (13.6-14)
2.3 ± 0.3° 2.34 ± 0.2bc 2.64 ± 0.1abc 2.6 ± 0.1abc 2.5 ± 0.2a 2.5 ± 0ab 2.6 ± 0.4a 2.84 ± 0.2bc 2.8 ± 0.2bc
DGO from stylet base (1.9-2.5) (2.1-2.5) (2.5-2.7) (2.4-2.7) (2.2-2.7) (2.4-2.5) (2.1-3.2) (2.5-3.1) (2.5-3.1)
45.8 ± 2.5ctl 47.28 ± 3abctl 46.92 ± 2.1abc 47.4 ± l.7abctl 47.4 ± 3.111 50.4 ± 5.8bctl 51.5 ± 0.5a 44.8 ± 1.3ab 49.9 ± 3.9abctl
Tail length (42-48.8) (44-51) (44.4-49.6) (44.8-49.6) (42.4-50.4) (44.8-59.2) (51-52) (43.2-46.4) (45.2-55)
3.9 ± 0.7ab 3.92 ± 0.2ab 3.44 ± 0.5a 3.9 ± 0.3ab 4 ± 0. lab 3.6 ± 0.5ab 3.1 ±0b 3.4 ± 0.5ab 4 ± 0.7a
Tail width at hyaline portion (3.2-5) (3.6-4) (3-4) (3.6-4.3) (4-4.2) (3-4) (3-3.1) (3-4) (3-5)
29 ± 2C 29.7 ± 1.9° 29.2 ± 2.3ab 30.6 ± 1.8bc 30.7 ± l.lab 29.2 ± 3abc 35 ± 2.T 32.3 ± 1.8° 33.3 ± 4.3bc
a ratio (26.3-31.8) (26.9-31.6) (25.7-32.2) (28.3-33.3) (29.3-31.9) (24.3-32.1) (32.1-38.9) (30.8-34.7) (27.7-37.8)
2.1 ± 0.3ab 2.1 ± 0.5ab 2.2 ± 0.7ab 1.9 ± 0.1ab 1.7 ± 0.2ab 2.6 ± 0.6ab 2.1 ± 0.3ab 1.8 ± 0.2b 2.2 ± 0.4a
Head width/height (1.8-2.5) (1.7-2.9) (1.7-3.3) (1.8-2) (1.5-1.9) (2-3.6) (1.7-2.5) (1.5-2) (1.7-2.5)
3.4 ± 0.7° 3.3 ± 0.4° 4.2 ± lab 3.5 ± 0.2bc 3.6 ± 0.6abc 4.6 ± l.labc 4.4 ± 0.1° 4.2 ± 0.5a 3.3±0.3bc
Caudal ratio A (2.6-4.3) (2.8-3.8) (3-5.1) (3.2-3.8) (3.2-4.5) (3.6-6.4) (4.2-4.5) (3.6-4.8) (2.9-3.7)
1 Means in the same row followed by the same letter are not significantly different stP = 0.05, according to Tukey's HSD Multiple comparison test.
Fig. 2. Scanning electron micrographs of Meloidogyne hapla isolate HRBB100. A & B: male face view and head lateral view; C: lateral field and tail; D & E: spicule. F: female face view; G & H: typical perineal pattern. I: second-stage juvenile face view; J: head lateral view; K, L & M: lateral field and tail.
PPSC3093 : TGAGGAGGACACGGATAGAGTCGGCGTATCTTGCAAGTATTCAATTACTTTATTATTGTGTTGTTATCTCTGAGCT : 76
GQ13013 : .........A.................................................................. : 76
FLMB2 4 : .........A.................................................................. : 76
JKI-de : .........A.................................................................. : 76
STRB6 : .........A.................................................................. : 76
GUNB2 6 : .........A......................................................G........... : 76
PPSC3093 : CCAGATTGGGACAGAGGAAAGCAGCATGATTTAATGTGATGCATTTACTTGTCTGGTGTGTGGGGGTATCTTAAGA : 152
GQ13013 : .......................................................................-.... : 151
FLMB24 : .......................................................................-.... : 151
JKI-de : .......................................................................-.... : 151
STRB6 : .......................................................................-.... : 151
GUNB2 6 : ................................TT............G....C...................-G... : 151
PPSC3093 : TGGATTTGCAACCAATGTTTTGAGGCCAGCTTGCTGGTACCCAAACATTGTTAACATTTTTTATCTTGGATATTCG : 228
GQ13013 : ............................................................................ : 227
FLMB2 4 : ..............................................G............................. : 227
JKI-de : ............................................................................ : 227
STRB6 : ............................................................................ : 227
GUNB2 6 : .........TG...................................G.....T......................T : 227
PPSC3093 : AGTACGGCTTACGTGCATTTTTTGTATTGATCTAAGTGCAAGTTACGGTCGCATGCGACACGTGCTTTTCATTTAG : 304
GQ13013 : ............................................................................ : 303
FLMB24 : ...................................A...................................A.... : 303
JKI-de : ............................................................................ : 303
STRB6 : ...................................A..........C.........C................... : 303
GUNB2 6 : .A..........C...........G...C.A.......G.......C.....C...C..C...............C : 303
PPSC3093 : TTCGGTGCAGTTAATGCTCTCGTACTCTCCCCCCATGTAAAAGCCGGTCATCTATTTGACCCGTCTTGAAACACGG : 38C
GQ13013 : ............................................................................ : 379
FLMB2 4 : ...................................A........................................ : 379
JKI-de : ............................................................................ : 37 9
STRB6 : ........................................................................C.C. : 378
GUNB2 6 : ...C.....................C.........A...........G...T.....C.A.....C......C.C. : 379
PPSC3093 : ACCAAGGAGTTTATCGTGTGCGCAAGTTTTTGGGTGTTAAAAACCTAGAAGCGAAATGAAAGTAAATGATTCTTTA : 456
GQ13013 : ............................................................................ : 455
FLMB2 4 : ............................................................................ : 4 55
JKI-de : ...............................................A............................ : 455
STRB6 : ....................................................C................A...... : 455
GUNB2 6 : .......G....T..C...............................C............................ : 455
PPSC3093 : GAGTCTGATGTGCAATCTTTTTTCAGAAAAGTGCATCATGGCCCC-ATTCTAACTGTTTACAGTAGGGTGGCGGAA : 531
GQ13013 : .............................................-.............................. : 530
FLMB2 4 : .............................................-.............................. : 530
JKI-de : .........................A...........C.......-.............................. : 530
STRB6 : .......................TCA...........C.......-.............................. : 530
GUNB2 6 : T........................A...................C...................A.......... : 531
PPSC3093 : GAGCGTACGCGGTGAGACCCGAAAGATGGTGAACTATTCCTGAGCAGGACGAAGCCAGAGGAAACTCTGGTGGAAG : 607
GQ13013 : ............................................................................ : 606
FLMB2 4 : ............................................................................ : 606
JKI-de : ........................T................................................... : 606
STRB6 : .....................................................A.....C................ : 606
GUNB2 6 : ............................................................................ : 607
PPSC3093 : TCCGAAGCGGTTCTGACGTGCAAATCGATCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTA : 683
GQ13013 : ....................................................................T....... : 682
FLMB2 4 : ............................................................................ : 682
JKI-de : ......C.T.................T.............T................................... : 682
STRB6 : .................C.....C.................................................... : 682
GUNB2 6 : ............................................ATA............................. : 683
Fig. 3. Alignment of D2-D3 28S expansion segment gene of six selected Meloidogyne hapla isolates. Isolates
GUNB26, STRB6 and FLMB24 are from Ethiopia, whereas isolate PPSC3093 and JKI-de are newly obtained
sequences from The Netherlands and Germany, respectively. GQ130139 is from GenBank originally from China. Identical nucleotide positions are indicated with "." Indels are indicated with "—".
Fig. 4. Maximum Parsimony analysis of mtDNA (COII-16S) of Meloidogyne hapla isolates from Ethiopia and other related sequences. Sequences from GenBank are given their corresponding accession number in a parenthesis. Newly obtained sequences for isolates from Germany is in bold. Sequences for Ethiopian isolates are given by farm codes (STR, HRB, FYR, FLM, GUN, and ETD) followed by "B" + isolate number. All ambiguous positions were removed for each sequence pair. The analysis was performed using 1000 bootstrap replicates. The MP tree out of the several parsimonious trees was obtained using the Subtree-Pruning-Regrafting (SPR) algorithm by the random addition of sequences (10 replicates). Corresponding bootstrap values above 50% are shown on each node. Bursaphelenchus xylophilus has been used as an outgroup taxon.
both A and T had 0.44 while C and G on the other hand had same 0.06. The estimated gamma distribution shape parameter was 0.67 and the phylogenetic tree had a -ln likelihood of 2433.68. With a similar default search, the best sequence evolution model for the D2-D3 region obtained was K2+G representing the model Kimura 2-parameter (Nei & Kumar, 2000). Each base had equal frequency of 0.25 and the estimated gamma distribution shape parameter was 1.32. The phylogenetic tree obtained had a -ln likelihood of 5737.45.
Identification of M. hapla isolates based on sequences of the mtDNA (COII-16S) and rDNA region of the D2-D3 was in agreement with both morphological and morphometrical data. Phylogenetic trees of both genes demonstrated that M. hapla isolates from Ethiopia formed highly supported clades with those of published M. hapla isolates of different geographical origin (Fig. 4).
Phylogenetic analysis of mtDNA of the Ethiopian M. hapla isolates with M. hapla isolates and isolates other Meloidogyne species obtained from GenBank using Maximum parsimony formed three highly supported clades (Fig. 4): Clade I includes M. hispanica, M. javanica, M. arenaria and M. ethiopica; Clade II consists of only M. partityla, and Clade III contains M. hapla which was separated from the other Meloidogyne species with a bootstrap value of 99%. In turn, two M. hapla isolates from USA (AY757899, AY757900) and Brazil (AY942850) formed an independent subclade with 100% bootstrap, while other isolates from USA were placed into two highly supported subclades (93% bs). One subclade consists of M. hapla isolates from USA (AY539839, AY757903 and AY757902), Australia (L76262, FJ159608) and half of the Ethiopian isolates originally collected from higher altitude regions of Ethiopia except isolate HRBB107. The second subclade includes three isolates from USA (AY757889, AY757901, AY757887), one isolate from German (JKI-de) and the remaining isolates from Ethiopia. In summary, the Ethiopian M. hapla isolates were placed on the tree sandwiched between isolates originating from USA.
For the D2-D3 expansion segment, phylogenetic trees obtained with both ML and MP revealed consistent topology and thus the ML tree is presented here (Fig. 5). In ML phylogenetic analysis, Meloidogyne species formed two highly and moderately distinct clusters supported by bootstrap value 64% and 99%, respectively. The first highly supported cluster comprised all the tropical Meloidogyne species (M. incognita, M. javanica, M. arenaria, M. ethiopica, M. enterolobii,
M. thailandica and M. hispanica) sandwiched between the temperate species (M. graminis, M. marylandi, M. chitwoodi) and population of M. hapla. The second clade formed two subclades of M. hapla populations including: i) one isolate from Germany (jKI-de) separated from other isolates; and ii) isolates from China (JN005873, GQ130139, KJ755183, KJ598136), The Netherlands (DQ145641, PPSC3093), Moldova (DQ328685), and all isolates from Ethiopia.
DISCUSSION
In this study, on the basis of comprehensive molecular and morphological analysis, M. hapla from Ethiopia is characterised and compared to populations from other countries. In Ethiopia, several plant-parasitic nematode genera were reported to be associated with rose plants cultivated in different regions (Meressa et al., 2014a). Of these genera, Meloidogyne was frequent as well as abundant. Based on preliminary observation on morphology and morphometry of some characters, we identified M. hapla, which was unexpected in the tropical environment of Ethiopia. Thus, we propagated a pure culture and studied details of its morphology, morphometry and molecular characteristics as described in this paper.
Morphological and morphometrical analysis. The identification of M. hapla to species level might depend on a specific population that bears varying forms of morphological characters (Eisenback, 1982). Based on sampling locality, our isolates were roughly grouped into those from lowland (« 1600 m) or highland (> 2300 m) regions. Isolates obtained from Ziway locality represented the lowland regions. There were differences in morphometrics of some characters in female, male and J2 between the Ethiopian isolates. Quite striking was the fact that isolate HRBB107 collected from the lowland revealed considerable variation in some morphometrics from all other isolates. Unfortunately, we have no explanation for such differences because except for HRBB107 all other isolates from the same farm did show high similarity with the isolates collected from the highlands. Thus, the variation observed lacks consistent correlation with sampling localities to infer the type of environment from which they were sampled.
Some morphometrical measurements were found to distinguish the Ethiopian population from others. The Ethiopian female population was different from the Hawaiian in possessing wider body diameter (410 ^m vs 342.3 ^m) and narrower vulva slit (19 ^m vs 23.9 ^m). J2 were comparably larger in body
Table 5. Morphometrical comparison of Meloidogyne hapla female populations from Ethiopia, Hawaii, Jepson (1968) and East Africa. All measurements are in ^m as mean ± s.d. (value range) except for the last
column given as mean (value range)
Morphological character1 Ethiopia (this study) Hawaii (Handoo et al, 2005) Jepson (1987) East Africa (Whitehead, 1968)
Body length 577.1 ± 86.1 (442-877.6) a - 781 ± 76 (643-952) b 612 ± 118 (419-845) a
Body width 410 ± 55 (284-510.2) ab 342.3 ± 65.2 (225-495) a 492 ± 40 (426-559) b 430 ± 81 (311-561) a
Stylet length 14.4 ± 1.4 (12.4-17.7) b - 14.6 ± 0.53 (12-15) b 11(10-13)a
Stylet knob height 2.6 ± 0.4 (2-3.2) 2.5 ± 0.1 (2.5-3) - -
DGO from stylet base 4.9 ± 0.6 (3.4-6.2) 5.2 ± 0.5 (5-6.5) - 5 (4-6)
Inter-phasmids distance 20.2 ± 2.3 (14.5-26) a 20.9 ± 4.6 (12.5-30) a - 24.4 (17-38) b*
Vulva slit length 19 ± 2 (13-24) a 23.9 ± 2.7 (20-30) b - 19 (13-24.5) a*
Vulva slit to anus distance 16.7 ± 2 (13.6-23.6) 17.6 ± 2.7 (14-22.5) - 14.6 (9.5-24.5) *
Distance from anus to tail terminus 16.7 ± 2 (12.8-22.8) b 15.4 ± 3.3 (12.5-25) b - 9.3 (5.5-13) a*
* Measurements are from the original description of the species by Chitwood (1949).
1 Means in the same row followed by the same letter are not significantly different at P = 0.05, according to Tukey's HSD Multiple comparison test.
Table 6. Morphometrical comparison of Meloidogyne hapla second-stage juvenile populations from Ethiopia, Hawaii, Jepson (1968) and East Africa. All measurements are in ^m as mean ± s.d. (value range) except for the
last column given as mean (value range)
Morphological character1 Ethiopia (this study) Hawaii (Handoo et al., 2005) Jepson (1987) East Africa (Whitehead, 1968)
Body length 369.7 ± 21.6 (315-417) b 323.1 ± 18.4 (284-355) a - 337±11.4(312-355) a
Body width 12 ± 1 (9.6-15) 10.8 ± 0.9 (10-12) - -
Excretory pore to anterior end 73 ± 5 (60-84) 66.9 ± 7.6 (60-88) - -
Stylet length 13.4 ± 0.9 (10.4-15) - - 9.7 ± 0.9 (7.9-10.9)
DGO from stylet base 2.5 ± 0.3 (1.9-3.2) 2.5 ± 0 (2.5-2.5) - -
Tail length 47.9 ± 3.5 (42-59.2) b 42.6 ± 4.2 (30-47.5) a 59 ± 5.3 (48.2-69.8) c 43 ± 4 (33-48) a
Length of hyaline tail terminus 14 ± 2.1 (10-19.2) b 10.9 ± 2.1 (5-15) a 15.7 ± 1.7 (11.7-18.9) b -
Tail width at hyaline portion 3.7 ± 0.5 (3-5) 3.7 ± 0.5 (3-4.5) - -
Ratios -
a 31 ± 3 (24.3-38.9)b 30.2 ± 2.6 (24.1-35.5) b - 23.9±1.7(20.1-26.6)a
c 7.7 ± 0.6 (6.4-9.1) 7.7 ± 0.6 (6.8-9.4) - 7.9 ± 0.2 (7.3-10.2)
Caudal ratio A 3.8 ± 0.7 (2.6-6.4) 3 ± 0.7 (1.7-5) - -
1 Means in the same row followed by the same letter are not significantly different at P = 0.05, according to Tukey's HSD Multiple comparison test.
Table 7. Sequence similarity (%) of D2-D3 expansion segments of 28S rDNA of Meloidogyne hapla isolates from Ethiopia, The Netherlands (nl), Germany (de), China (cn) and Moldova (md). PPSC3093 and JKI-de are newly obtained sequences. Additional sequences from GenBank database are shown with theirs corresponding accession number
Isolates M. hapla populations
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
01. HRBB115 -
02. DQ328685 (md) 100 -
03. ETDB54 100 100 -
04. HRBB98 100 100 100 -
05. JN005873 (cn) 100 100 100 100 -
06. STRB4 96 96 96 96 96 -
07. ETDB47 94 94 94 94 94 93 -
08. GUNB26 92 92 92 92 92 92 90 -
09. HRBB107 84 84 84 84 84 84 83 86 -
10. GUNB42 92 92 92 92 92 91 89 93 84 -
11. HRBB95 98 99 99 99 99 96 93 92 83 92 -
12. FYRB60 99 99 99 99 99 97 94 93 85 93 97 -
13. FYRB66 99 99 99 99 99 96 94 92 85 92 98 100 -
14. STRB6 98 98 98 98 98 97 94 93 84 92 97 99 99 -
15. JKI-de (de) 99 99 99 99 99 95 93 92 83 91 98 98 98 97 -
16. PPSC3093 (nl) 100 100 100 100 100 96 94 92 84 92 99 99 99 98 99 -
17. FLMB24 99 99 99 99 99 97 95 92 84 92 98 98 98 98 98 99 -
18. HRBB100 100 100 100 100 100 96 94 92 84 92 99 99 99 98 99 100 99 -
19. HRBB82 100 100 100 100 100 96 94 93 85 92 99 99 99 98 99 100 99 100 -
20. HRBB103 98 99 99 99 99 97 94 93 84 92 98 98 98 97 98 99 99 99 99 -
21. FYRB67 99 100 100 100 100 97 94 92 84 92 99 98 99 98 99 100 100 100 100 99 -
22. ETDB44 97 98 98 98 98 95 93 91 84 91 97 96 97 97 97 98 98 98 98 97 98 -
23. HRBB112 98 99 99 99 99 96 93 93 85 92 98 98 98 98 98 99 99 99 99 98 99 97 -
24. FLMB18 99 99 99 99 99 96 94 93 85 92 98 98 99 98 98 99 99 99 100 99 100 98 99 -
25. GQ130139(cn) 100 100 100 100 100 96 94 92 84 92 99 99 99 98 99 100 99 100 100 99 100 98 99 99 -
26. DQ145641 (nl) 100 100 100 100 100 96 94 93 85 92 99 99 99 98 99 100 100 100 100 99 100 98 99 100 100 -
(V
o"
I
1 TO Sr-
f S"
T3 o ■a
S
o' »
W
Bt
o ■a
size (369.7 ^m vs 323.1 ^m) and had longer tail length (48 ^m vs 42.6 ^m). One population from The Netherlands was previously reported to have an average vulva slit length of 18.9 ^m, which is almost identical to the Ethiopian population (Handoo et al, 2005).
Our population differed from a population described from East Africa (Tanzania) in some morphometrics of female and J2 (Whitehead, 1968). The Ethiopian female had relatively shorter (577 ^m vs 612 ^m) and narrower (410 ^m vs 430 ^m) body compared to the East African population. There was also a considerable difference in female stylet length (11 ^m vs 14.4 ^m). On the other hand, the Ethiopian J2 had greater body size than the East African (369.7 ^m vs 337 ^m). The tail length of the Ethiopian population (48 ^m) falls between the East African (43 ^m) and the population described by Jepson (1987) (59 ^m). The smaller a ratio (23.6) of the East African J2 than the Ethiopian (31) J2 indicates that the Ethiopian population possess a thinner body.
Previously, based on J2 body length, the possible geographical origin of the Hawaiian population was suggested to be associated with the origin of Coffea arabica in Ethiopia. Although, a warmer environment might correlate with smaller J2 body size (Handoo et al, 2005), the Ethiopian J2 populations were apparently larger in size than both the East African and Hawaiian populations. Hence, it is unlikely that the Ethiopian population shares a similar origin with these two populations.
Molecular analysis. DNA based molecular diagnostics avoids ambiguous diagnosis in root-knot nematodes (Hyman, 1990). Amplification of mtDNA (COII-16S) produced a fragment size of approximately 540 bp in agreement with the reports by Orui (1998) and Powers & Harris (1993). Using the same primer pairs used here, the three tropical root-knot nematode species are consistently known to produce a typical mtDNA PCR fragment size of 1.7 kb for M. incognita and M. javanica and 1.1 kb for M. arenaria (Powers & Harris, 1993). Hence, our PCR product size gave the first indication that M. hapla could be discriminated at least from those known tropical root-knot nematode species. The presence of unusual PCR size polymorphism, even within isolates of same species as reported for M. incognita (Blok et al., 2002), shows that mere use of PCR fragment size is not sufficient for the correct identification of this species.
The PCR fragment size (740 bp) for D2-D3 expansion segment of 28S rDNA was not species-specific because M. incognita and M. chitwoodi included as a control also yielded the same fragment
size (data not shown). Nevertheless, sequence analysis of the PCR products of both genes confirmed the identity of our specimens as M. hapla.
Phylogenetic analysis. In our study, the MP analysis of the mtDNA gene of M. hapla isolates formed a highly supported clade together with other isolates retrieved from the GenBank. Nevertheless, considerable nucleotide variation has been observed within the Ethiopian isolates. For example, the overall sequence variability with in isolates was 11.5%. On the other hand, the sequence variability among those M. hapla isolates retrieved from the GenBank was 12%. Therefore, the sequence disparity observed between the Ethiopian isolates can be considered realistic. The rapid evolutionary nature of mtDNA (Powers et al., 1986) combined with the reproduction behaviour of M. hapla (Hugall et al, 1994) could explain the sequence variation observed between isolates.
Sequence variation in the D2-D3 region within isolates of M. hapla ranged from 0% to 17%. Subbotin et al. (2011) reported variability of 6% within clones of the same PCR for Helicotylenchus martini. Sequence variability in the rDNA within individuals of the same species has also been reported previously (De Ley et al., 2002). On the other hand, Blok et al. (2002) found identical D2-D3 sequence for three isolates of M. hispanica collected from different geographical origins. However, given our isolates were collected from different geographical regions; the level of heterogeneity observed between isolates may still be considered acceptable. Both ML and MP analysis of the two gene regions placed all the M. hapla isolates on a strongly supported clade separated from other Meloidogyne species.
Biogeography of Meloidogyne hapla. Accurate information on the species and distribution of particular plant-parasitic nematodes is important to develop appropriate control strategies. The occurrences of M. incognita, M. javanica, M. arenaria and M. ethiopica have been long known from Ethiopia (O'Bannon, 1975), whereas the occurrence of M. hapla in Ethiopia was only recently reported (Meressa et al, 2014a).
The most common tropical Meloidogyne species, M. incognita, M. arenaria and M. javanica, occur in areas with an average temperature up to 36°C (Taylor et al, 1982). Meloidogyne hapla is generally distributed in cooler parts of the world where it survives mean annual low temperature of -15°C, but also occurs in highland areas of tropical and subtropical countries where the temperature is below 27°C (Taylor et al., 1982). However, its occurrence in the rift valley of Ethiopia
-HRBB100
I GQ130139|M. hapla-, China| "I DQ145641 |M. hapla, Netherland| PPSC3093-N1 ¡M. hapla, Netherland| KJ598136 |M. hapla, China| DQ328685|M. hapla, -KJ755183 |M. hapla, China| HRBB98 HRBB115
-ETDB54
- JKI-de |M. hapla, Germany| 9 KF482372 ¡M. ethmpi^
- KF482374 |M. incoдnita|
[- EU443606 |M. hispanica| 621 1 KF501128 |M. hispanical
JN005866 |M. enterolobiil KJ146862 |M. enterolobiil - IQ317912 |M. javanica| r EU364890 |M. thailand^
- KF112873 |M. arenaria| |l AF435803 |M. arenaM
f JX100424 |M. incognita| -KC953092 |M. javanica|
- JN019321 ¡M. chitwoodi|
JJN019363 |M. marylandi| IN019351 |M. marylandi|
_| JN019339 |M. graminisl
93-JN157849 |M. graminis|
-HM623784 |Bursaphlenchus africanus|
Fig. 5. Maximum Likelihood analysis of the D2-D3 expansion segment of 28S ribosomal DNA of Meloidogyne hapla isolates from Ethiopia and other related sequences. Sequences from GenBank are given with their corresponding accession number. Newly obtained sequences for isolates from The Netherlands and Germany are in shown in bold. Whereas sequences for Ethiopian isolates are given by farm codes (STR, HRB, FYR, FLM, GUN and ETD) followed by "B" + isolate number. The analysis was performed using 1000 bootstrap replicates. Corresponding bootstrap support more than 50% are given for each appropriate clade. Bursaphelenchus africanus has been used as an outgroup taxon.
(Meressa et al, 2014a), South Africa (Onkendi & Moleleki, 2013) and highlands of Tanzania (Whitehead, 1968) might indicate a possible wider climate range of this species than previously expected. The temperature of our sampling localities generally varied throughout the year but can reach up to 35°C, which is already suboptimal temperature conditions for this species, thus reducing its pathogenicity (Wong & Mai, 1973). However, the fact that rose glasshouses used shading and irrigation to reduce temperature peaks might have helped M. hapla to establish and cause damage under those otherwise extreme conditions.
Although M. hapla was shown under experimental conditions to multiply on cut-flower species other than roses, such as on statice, carnation, gypsophila and freesia (Meressa et al., 2014b), M. hapla was not detected on these cut-flower species in Ethiopia (Meressa et al, 2014a). One reason for this restricted distribution might be that M. hapla was introduced to Ethiopia with rooted rose plants, whilst for the other cut flowers seeds were used that are free of M. hapla. This hypothesis is supported by the fact that the Ethiopian isolates shared high sequence similarity with M. hapla populations from other part of the
world. Consequently, M. hapla might have a historical connection with the import of rose rootstocks on growth media from outside Ethiopia.
In conclusion, the association between M. hapla and rose cut-flowers will remain a challenge to the growers in Ethiopia. Optimistically, this report will trigger alarm and generate a coordinated search for sustainable management strategies for M. hapla on rose cut-flowers.
ACKNOWLEDGEMENTS
The authors thank Falko Lange and Agnes Windt for their technical assistance in nematode propagation. We also thank Wim Bert and Marjolein Couvreur, Gent University, Department of Biology who made the SEM images. Isolate PPSC3093 was obtained from Prof. Gerrit Karssen. The first author is also grateful to the German Academic Exchange Service for the financial support.
REFERENCES
Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410. Baldwin, J.G., Frisse, L.M., Vida, J.T., Eddleman, C.D. & Thomas, W.K. 1997. An evolutionary framework for the study of developmental evolution in a set of nematodes related to Caenorhabditis elegans. Molecular Phylogenetic and Evolution 8: 248-259.
Birithia, R., Waceke, W., Lomo, P. & Masiga, D. 2012. Identification of root-knot nematode species occurring on tomatoes in Kenya: use of isozyme phenotypes and PCR-RFLP. International Journal of Tropical Insect Science 32: 78-84. Blok, V.C.B, Wishart, J.W., Fargette, M.F., Berthier, K.B. & Philips, M.S. 2002. Mitochondrial DNA differences distinguishing Meloidogyne mayaguensis from the major species of tropical root-knot nematodes. Nematology 4: 773-781. Chitwood, B.G. 1949. Root-knot nematodes. Part I. A revision of the genus Meloidogyne Goeldi, 1887. Proceedings of the Helminthological Society of the Washington 16: 90-104. COURTNEY, W.D., POLLEY, D. & MILLER, V.L. 1955. TAF, an improved fixative in nematodes technique. Plant Disease Report 39: 570-571. De Ley, I.T., De Ley, P., Vierstraete, A., Karssen, G., Moens, M. & Vanfleteren, J. 2002. Phylogenetic analyses of Meloidogyne small subunit rDNA. Journal of Nematology 34: 319-327.
De Luca, F., Reyes, A., Troccoli, A. & Castillo, P. 2011. Molecular variability and phylogenetic relationship among different species and populations of Pratylenchus (Nematoda: Pratylenchidae) as inferred from the analysis of the ITS rDNA. European Journal of Plant Pathology 130: 415-426.
De Waele, D. & Elsen, A. 2007. Challenges in tropical plant nematology. Annual Review of Phytonematology 45: 457-485.
Eisenback, J.D. 1982. Morphological comparison of head shape and stylet morphology of second-stage juveniles of Meloidogyne species. Journal of Nematology 14: 339-343.
Handoo, Z.A., Skantar, A.M., Carta, L.K. & Schmitt, D.P. 2005. Morphological and molecular evaluation of a Meloidogyne hapla population damaging coffee (Coffea arabica) in Maui, Hawaii. Journal of Nematology 37: 136-145.
Hooper, D.J. 1970. Handling, fixing, staining and mounting nematodes. In: Laboratory Methods for Work with Plant and Soil Nematodes (J.F. Southey Ed.). pp. 39-54. London, UK, Ministry of Agriculture, Fisheries and Food.
Hooper, D.J., Hallmann, J. & Subbotin, S. 2005. Extraction, processing and detection of plant and soil nematodes. In: Plant Parasitic Nematodes in Subtropical and Tropical Agriculture (M. Luc, R.A. Sikora & J. Bridge Eds.). pp. 53-86. Wallingford, UK. CABI Publishing.
Hugall, A., Moritz, C., Stanton, J. & Wolstenholme, D.R. 1994. Low, but structured mitochondrial DNA diversity in root knot nematodes (Meloidogyne). Genetics 106: 903-912.
Hunt, D.J., Luc, M. & Manzanilla-Lopez, R.H. 2005. Identification, morphology and biology of plant parasitic nematodes. In: Plant Parasitic Nematodes in Subtropical and Tropical Agriculture (M. Luc, R.A. Sikora & J. Bridge Eds.). pp. 11-52. Wallingford, UK, cABi Publishing.
Hyman, B.C. 1990. Molecular diagnosis of Meloidogyne species. Journal of Nematology 22: 24-30.
Jepson, S.B. 1987. Identification of Root-Knot Nematodes (Meloidogyne Species). UK, CABI Publishing. 265 pp.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. & Higgins, D.G. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.
Meressa, B.-H., Dehne, H.-W. & Hallmann, J. 2011. Occurrence of plant-parasitic nematodes in cut-flowers of Ethiopia. Berichte aus dem Julius KühnInstitut: Julius Kühn-Institut, Germany, 55 pp.
Meressa, B.-H., Dehne, H.-W. & Hallmann, J. 2014a. Plant parasitic nematodes of cut-flowers in Ethiopia. International Journal of Nematology 24: 1-10.
Meressa, B.-H., Dehne, H.-W. & Hallmann, J. 2014b. Host suitability of cut-flowers to Meloidogyne spp. and population dynamics of M. hapla on the rootstock Rosa corymbifera 'Laxa'. American Journal of Experimental Agriculture 4: 1397-1409.
Nagesh, M. & Reddy, P.P. 2005. Management of carnation and gerbera to control the root-knot nematode, Meloidogyne incognita, in commercial polyhouses. Nematologica Mediterranea 33: 157-162.
Nei, M. & Kumar, S. 2000. Molecular Evolution and Phylogenetics. USA, Oxford University Press. 333 pp.
Nicholas, K.B., Nicholas, H.B.J. & Deerfield, D.w. 1997. GeneDoc: analysis and visualization of genetic variation. Embnew News 4: 14.
O'BANNON, J.H. 1975. Report of nematode survey in Ethiopia. Ethiopia, IAR & Italy, FAO. 29 pp.
Onkendi, E.M. & Moleleki, L.N. 2013. Detection of Meloidogyne enterolobii in potato in South Africa and phylogenic analysis based in intergenic region and mitochondria DNA sequence. European Journal of Plant Pathology 136: 1-5.
Orui, Y. 1998. Identification of Japanese species of the genus Meloidogyne (Nematoda: Meloidogynidae) by PCR-RFLP analysis. Applied Journal of Entomology and Zoology 33: 43-51.
Powers, O.T., Platzer, E.G. & Hyman, B.C. 1986. species-specific restriction polymorphism in root-knot nematode mitochondria DNA. Journal of Nematology 18: 288-293.
Powers, T.O. & Harris, T.S. 1993. A polymerase chain reaction method for identification of five major Meloidogyne species. Journal of Nematology 25: 1-6.
Subbotin, S.A., Inserra, R.N., Marais, M., Mullin, P., Powers, T.O., Roberts, P.A., van den Berg, E., Yeates, G.W. & Baldwin, J.G. 2011. Diversity and phylogenetic relationships within the spiral nematodes of Helicotylenchus Steiner, 1945 (Tylenchida: Hoplolaimidae) as inferred from analysis of the D2-D3 expansion segments of 28S rRNA gene sequences. Nematology 13: 333-345.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
Taylor, A.L, Sasser, J.N. & Nelson, L.A. 1982. Relationship of climate and soil characteristics to geographical distribution of Meloidogyne species in agricultural soils. A cooperative publication of the Department of Plant Pathology, North Carolina State university and the united states Agency for International Development: North Carolina State
university, usA, 69 pp.
Whitehead, A.G. 1968. Taxonomy of Meloidogyne (Nematoda: Heteroderidae) with descriptions of four new species. Transactions of the Zoological Society of London 31: 263-401.
WONG, T.K. & Mai, W.F. 1973. Pathogenicity of Meloidogyne hapla to lettuce as affected by inoculum level, plant age at inoculation and temperature. Journal of Nematology 5: 126-129.
Zijlstra, C., Donkers-Venne, D.T.H.M. & Fargette, M. 2000. Identification of Meloidogyne incognita, M. javanica and M. arenaria using sequence characterized amplified region (SCAR) based PCR assays. Nematology 2: 847-853.
B.-H. Meressa, H. Heuer, H.-W. Dehne and J. Hallmann. Молекулярная и морфологическая характеристика популяций Meloidogyne hapla из Эфиопии.
Резюме. Вид Meloidogyne hapla часто рассматривается как форма, характерная для регионов с умеренным климатом. Недавно этот вид был выявлен в Эфиопии в теплицах с розами. Розы представляют собой основную культуру в более чем 80% хозяйств, экспортирующих срезанные цветы из Эфиопии. В последнее время эти хозяйства сталкиваются с серьезными проблемами из-за поражения нематодами. Образцы почвы из случайно выбранных 12 хозяйств были собраны в 6 административных районах вокруг Аддис-Абебы. На девяти из них были выявлены нематоды рода Meloidogyne, а на шести - нематоды вида M. hapla. Чистые лабораторные культуры мелойдогин были основаны с использованием яйцевых масс от 125 одиночных особей, происходивших из этих 6 хозяйств. В качестве растения-хозяина использовали томаты сорта 'Moneymaker'. Основываясь на морфологических и молекулярных данных, 82 культуры были идентифицированы как M. hapla. Морфологические особенности этих нематод были исследованы с помощью светового и сканирующего электронного микроскопа. Морфологические и морфометрические признаки самок, самцов и личинок 2-й стадии (J2) сравнивали с данными по популяциям M. hapla из различных стран. Проведенная молекулярно-таксономическая характеристика эфиопских популяций основывается на последовательностях D2-D3 сегмента большой субъединицы рибосомы и участке митохондриального генома, лежащего между генами COII и 16S мтДНК. Морфологические особенности самок, самцов и J2 соответствовали таковым у других популяций M. hapla, с некоторыми различиями в морфометрических параметрах. Вульварные пластинки эфиопских популяций соответствовали первоописанию, но были меньше по размерам, чем у форм, исследованных Джепсоном (Jepson, 1987). Размеры тела у J2 были крупнее, чем у ранее исследованных популяций с Гавайских островов или из Восточной Африки, а индекс a был выше, чем у восточноафриканских популяций, и сходным с таковым у гавайских форм. Филогенетический анализ взаимоотношений эфиопских популяций M. hapla с другими популяциями этого вида по последовательностям мтДНК и D2-D3 сегмента рДНК выявил высокую статистическую поддержку эволюционной линии, объединяющей популяции из Эфиопии с исследованными популяциями из различных стран мира.
