Трансформация экосистем iivM^i Ecosystem Transformation
'•у www.ecosysttrans.com
Invasive taxa of the genus Solidago L. in the vicinity of the city of Pskov
Maria A. Galkina*, Yuliya K. Vinogradova
N.V. Tsitsin Main Moscow Botanical Garden, Russian Academy of Sciences, Botanicheskaya str. 4, Moscow, 4127276 Russia
Received: 07.02.2019 Accepted: 24.02.2019 Published online: 20.05.2019
DOI: 10.23859/estr-190207 UDC 575.858:582.998.1(470) URL: http://www.ecosysttrans.com/ publikatsii/detail_page.php?ID=116
ISSN 2619-094X Print ISSN 2619-0931 Online
Translated by S.V. Nikolaeva
Three taxa of the genus Solidago occur in the vicinity of Pskov: S. virgaurea, an aboriginal species, S. canadensis, an invasive species of North American origin, and their hybrid S. x nie-derederi. We studied the morphology of the hybrid and parental species. The diameter of the S. * niederederi flower heads is intermediate between those in S. virgaurea and S. canadensis. The hybridogenic origin of S. x niederederi was demonstrated using molecular analysis of nucleotide sequences of nuclear DNA (ITS region). At present, it is not possible to unequivocally determine which of the parental species was maternal and which was paternal. By analyzing the highly variable noncoding loci of chloroplast DNA (rpl32-trnL), it can be assumed that hybridization proceeds in both directions.
Keywords: invasions, hybridization, Solidago canadensis, S. x niederederi, S. virgaurea, flower heads diameter, ITS region, chloroplast loci rpl32-trnL.
Galkina, M.A., Vinogradova, Yu.K., 2019. Invasive taxa of the genus Solidago L. in the vicinity of the city of Pskov. Ecosystem Transformation 2 (2), 12-18.
Introduction
Invasions of alien species lead to the depletion of the flora of vast territories and may cause economic damage (McGeoch et al., 2010; Vinogradova et al., 2010). The North American species Solidago canadensis (Linnaeus, 1753) is among the top one hundred most aggressive invasive species in Russia (Vinogradova et al., 2015). Indeed, when a foreign species is becoming naturalized, there is an interaction with representatives of the native flora, which can also lead to the formation of hybrids. There is a hypothesis that in secondary ranges, the intensity of hybridization processes increases (Ellstrand and Schierenbeck, 2000; Elton, 1958). Moreover, hybrids may be more adapted to the conditions of the new environment than their parental taxa (Abbott et al., 2003; Bleeker et al., 2007; Zalapa et al., 2009). In European Russia, hybrids make up 10% of the total number of invasive species (Vinogradova and
Mayorov, 2015). Parent species of the European hybrid S. x niederederi (Khek, 1905) are S. canadensis and S. virgaurea (Linnaeus, 1753). Populations of S. x niederederi have been recorded in Austria, Great Britain, Lithuania and Poland (Pagitz, 2016), and over the past decades it has significantly expanded its range (Karpaviciene and Radusiene, 2016; Pliszko and Zaj^c, 2016). In our previous studies using the ISSR method, it was found that plants collected in European Russia, identified using morphological features as S. x niederederi, are highly likely to be of hybrid origin (Vinogradova and Galkina, 2019), however that can only be confirmed by analyzing the nucleotide DNA sequences of the presumed hybrids and parents. We aimed to study the features of Solidago hybrids in northwestern Russia, since the most numerous recent records of S. x niederederi are from northeastern Europe, to which the Pskov region is the most closely located region of Russia.
Previously, based on an analysis of the highly variable non-coding chloroplast rpl32-trnL locus, Pliszko and Zalewska-Gatosh (2016) found that hybridization between S. canadensis and S. virgaurea can go both ways, and both species can be either maternal or paternal plants. We aim to determine which situation, with respect to the parental taxa, is observed in the Pskov populations of these species.
Materials and methods
The diameter and length of the flower heads were measured using a Keyence VHX-1000 digital microscope. For each of the three taxa, we measured 30 flower heads from plants collected in the Pskov region (Pskov district, vicinity of Pskov, an unused field near a highway). Statistical data were processed in the PAST 3 program.
DNA extraction was carried out using the CTAB method (Rogers and Bendich, 1985) from herbarium material collected in the Pskov and Moscow regions (Table 1). In the Moscow region, representatives of the parental species were collected at two sites, in the Losiny Ostrov National Park (in a pine forest with spruce and birch) and in the vicinity of the village of Chudinovo in the Chekhov district (an unused field). These additional samples were used to more accurately assess the polymorphism of the invasive species S. canadensis and the native S. virgaurea in European Russia, as well as to control for incorrect interpretation of the results of the analysis of chloro-plast DNA loci to determine the maternal species.
Polymerase chain reaction (PCR) was performed in a DNA Engine Dyad Peltier Thermal Cycler amplifier (Biorad, USA). For the nuclear region of ITS, the
Table 1. Samples of various taxa of the genus Solidago L. (presumed S. x niederederi hybrid and parental species) used for molecular genetic analysis.
The number Sample of the ITS number sequence in GenBank
The number of the rpl32-trnL locus in GenBank
Taxon
Collection site and habitat
Collection year
v 1a
MK491849
MK474079
v 1b MK491850
v 1c
MK491851
n 2a MK491852
n 2b MK491853
n 2c
c 3a MK491854
c 3b MK491855
c 3c MK491856
MK474080 MK474081 MK474082 MK474083 MK474084 MK474085 MK474086 MK474087
S. virgaurea
Pskov region, Pskov S x niederederi district, vicinity of Pskov, 2018 S. x niederederi idle field, N 57.80°, 2018
E 28.25°
S. canadensis
v 4
c 5a MK491857
c 5b
MK474088 MK474090 MK474089
S. virgaurea
S. canadensis
Moscow region, Chekhov district, near the village of Chudinovo, idle field, N 55.1°, E 37.5°
2018
v_6a MK491858 - Moscow region, "Losiny
S viraaurea Ostrov" National Park, 2014
6. virgaurea pine forest, N 55.89°, 2014
v_6b MK491859 - E 37.77°
primers nnc18s10 (forward) and c26A (reverse) were used at an annealing temperature of 50 °C. For the chloroplast locus rpl32-trnL, primers rpl32F (forward) and trnL UAG (reverse) were used at an annealing temperature of 0.3 to 65 °C according to J. Shaw et al.'s (2007) method. The same PCR conditions were adopted for another chloroplast locus, trnL-trnF (primers c and f). The PCR products were purified for sequencing using the ammonium/Ethanol mixture protocol. Determination of nucleotide DNA sequences was carried out using an automatic sequencer
in ZAO "Syntol". The nucleotide sequences were further processed using the BioEdit software. The data obtained were deposited into the GenBank database (https://www.ncbi.nlm.nih.gov/nuccore), where these nucleotide sequences can be found using their assigned numbers (Table 1).
Results and discussion
The main difference between S. x niederederi and his parents is the structure of the shoot systems (mainly the structure of the inflorescence, Fig. 1). In
Fig. 1. Flower head morphology of Solidago x niederederi and its parental species.
Fig. 2. Parameters of flower heads of Solidago x niederederi and its parental species: quartiles (1st and 3rd), median, maximum and minimum values are indicated.
Fig. 3. Flower heads of Solidago x niederederi with a measurement scheme.
S. canadensis, numerous flower heads are assembled in loose panicles; in S. x niederederi flower heads are fewer and they are compressed in a compressed panicle, whereas in S. virgaurea the number of flower heads is the lowest, and the branches of the panicle are so short that the inflorescence resembles a spike. The sizes of the flower heads are also different (Fig. 2). The flower heads of S.x niederederi (Fig. 3) are oval in shape and are intermediate in diameter between the parental species - 2201 ± 45 jm (mean ± standard error) with a maximum spread from 1762 to 2728 jm, whereas for S virgaurea and S. canadensis these values are 3132 ± 30 jm (2874-3548 |jm) and 1591 ± 22 |jm (1428-1939 |jm), respectively. As for the length of the flower heads, the Pskov representatives of S. x niederederi cannot be clearly distinguished from S. canadensis using this character, due to its high variability in S. canadensis. However, according to mean lengths of flower heads, the hybrid also occupies an intermediate position between the parental species (Fig. 2). The shoots of S. canadensis and S. x niederederi are pubescent, whereas the shoots of S. virgaurea are bare, shiny, and sometimes reddish in color. The leaves of S. x niederederi in the middle part of the shoot are
Table 2. ITS polymorphism for the Solidago x niederederi hybrid and parental species. The nucleotides are coded using IUPAC nomenclature.
Sample Position in alignment
no. 384 431 508 549
v_1a T A C A
v_1b T A C A
v_1c T A C A
n_2a Y M Y R
n_2b Y M Y R
c_3a C C T G
c_3b C C T G
c_3c Y M T R
c_5a C C T G
v_6a T A C A
v 6b T A C A
a>
Tabe 3. Polymorphism of the rpl32—trnL region for the Solidago x niederederi hybrid and parental species. The nucleotides are coded using IUPAC nomenclature.
O
7T
Sample no. 191 242-264 Position in alignment 271-306 (292-330) 739-741 (746-748, 709-714) 894 (900, 923)
v_1a A - TGTCTAAAAGAATAATTCTTGTATTTCTT T C
v_1 b C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT T C
v_1c C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT - C
n_2a C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT - C
n_2b C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT T C
n_2c C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT T C
c_3a A GAATCTTAATGTTATGTCTAAA TGTCTAAAAGAATAATTCTTGTATTTCTT T A
c_3b A - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT TTTT A
c_3c C - - - C
v_4 C - TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT TT C
c_5a C - - T C
c_5b A - - TTTT A
> <
o
CQ
—5
£B Q.
O <
p <
c
ro o
m
8
I
CO
Co
S1
o ho
fo
ro I
linear-lanceolate, dentate along the edge, with three distinct veins (as in S. canadensis), and in the basal part of the shoot are large, ovate, with a reticulated venation (as in S. virgaurea).
To confirm the hybridogenic origin of the S. x niederederi population in the vicinity of Pskov, the nucleotide sequences of the nuclear and chloroplast DNA of Pskov individuals (both parental and hybridogenic species), as well as individuals of the parental species from the Moscow region, were analyzed. The analysis of the ITS region showed that in all cases of nucleotide substitutions differentiating S. virgaurea and S. canadensis, S. x niederederi had ambiguous readings (Table 2), indicating heterozygosity, which confirms the hybrid origin of individuals from this population. One of the samples of S. canadensis (c_3c) in three cases of four of the nucleotide substitutions showed heterozygosity, although morphologically this sample did not differ from other individuals of S. canadensis, which indicates the presence of introgressive hybridization within the genus Solidago. This sample is probably a backcross (i.e., the result of crossing S. x niederederi with the parental species S. canadensis).
Analysis of the highly variable intergenic spacer rpl32-trnL did not produce an unambiguous answer of which of the species is maternal for S. x niederederi, and which is paternal. Unlike the results obtained by A. Pliszko and Z. Zalewska-Galosh (2016), our S. canadensis samples show higher variability of this locus of chloroplast DNA. For instance, sample c_3a from the Pskov region has a DNA fragment, which is absent in other representatives of S. canadensis not only from Pskov, but also from the Moscow region (242-264 nucleotides, Table 3). The locus in positions 271-306 in the alignment of our sequences (292-330 for sample c_3a, Table 3) and differentiating the parental species in Polish populations (Pliszko and Zalewska-Gatosh, 2016) may differ not only in S. x niederederi but in both parental species. The analysis of another noncoding region of the chloroplast DNA (trnL-trnF), also did provide us with an answer, as all the samples under study turned out to be identical in this region. Based on the data obtained, we can only assume that in the Pskov population hybridization proceeds in both directions, but there is also the probability that only one species can be maternal and the other paternal, and a search for other, more prominently variable regions of chloroplast DNA is required. This is a subject for further study.
Conclusions
In the unused field studied in the vicinity of Pskov, three taxa occur together: S. canadensis (an invasive species of North American origin), S. virgaurea (a native species) and their hybrid S. x niederederi. This was confirmed by analyzing the ITS sequences of nu-
clear DNA. As both parents, especially S. canadensis, are relatively polymorphic taxa, it is not possible to unequivocally determine which of the two species is maternal, and which is paternal. The presence of introgressive hybridization within the genus Solidago is highly probable.
Acknowledgments
The study was performed within the framework of the State Contract of the GBS of the Russian Academy of Sciences (no. 19-119012390082-6) with partial support from the Russian Foundation for Basic Research (project no. 18-04-00411).
References
Abbott, R.J., James, J.K., Milne, R.I., Giles, A.C.M., 2003. Plant introduction, hybridization and gene flow. Philosophical Transactions of the Royal Society 358,1123-1132.
Bleeker, W., Schmitz, U., Ristow, M., 2007. Interspecific hybridization between alien and native plant species in Germany and its consequences for native biodiversity. Biological Conservation 137 (2), 248-253.
Ellstrand, N.C., Shierenbeck, K.A., 2000. Hybridization as a stimulus for the evolution of invasiveness in plants? Proceedings of the American Society of Naturalists 97 (13), 7043-7050.
Elton, C.S., 1958. The ecology of invasions by animals and plants. Methuen, London, Great Britain, 212 p.
Karpaviciene, B., Radusiene, J., 2016. Morphological and anatomical characterization of Solidago x niederederi and other sympatric Solidago species. Weed Science 64 (1), 61-70.
McGeoch, M.A., Butchart, C.H.M., Spear, D. et al., 2010. Global indicators of biological invasion: species numbers, biodiversity impact and policy responses. Diversity and Distributions 16, 95-108.
NCBI. Nucleotide. The Nucleotide database is a collection of sequences from several sources, including GenBank, RefSeq, TPA and PDB. Genome, gene and transcript sequence data provide the foundation for biomedical research and discovery. Web page. URL: https://www.ncbi.nlm.nih.gov/ nuccore (accessed: 28.02.2019).
Pagitz, K., 2016. Solidago x niederederi(S. canadensis x s. virgaurea ssp. virgaurea) in the Eastern Alps. Abstracts of Conference "Neobiota 2016". Foundation faune-flore, Vianden, Luxembourg, 194.
Pliszko, A., Zaj^c, M., 2016. Current and potential distribution of Solidago x niederederi (Asterace-ae) in Poland. Abstracts of Conference "Neobiota 2016". Foundation faune-flore, Vianden, Luxembourg, 163.
Pliszko, A., Zalewska-Gatosh, J., 2016. Molecular evidence for hybridization between invasive Solidago canadensis and native S. virgaurea. Biological Invasions 18, 3103-3108.
Rogers, S.O., Bendich, A.J., 1985. Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Molecular Biology 5, 69-76.
Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phy-logenetic studies in Angiosperms: the tortoise and the hare III. American Journal of Botany 94 (3), 275-288.
Vinogradova, Yu.K., Galkina, M.A., 2019. Gibridizat-siya kak faktor invazionnoy aktivnosti chuzherod-nyh vidov zolotarnika (Solidago) [Hybridization as a factor of invasive activity alien species of Goldenrods (Solidago L.)]. Zhurnal obshey biologii [Journal of General Biology] 80 (1), 43-56. (In Russian).
Vinogradova, Yu.K., Mayorov, S.R., 2015. Dlitelnost lag-fazy kak otrazhenie mikroevolutsii rasteniy vo vtorichnom areale [Period of lag-phase as mirror of plant microevolution in the secondary distribution range]. Materialy XIII Moskovskogo soveshaniya po filogenii rasteniy "50 let bez K.I. Meyera" [Abstracts of XIII Moscow conference about Plant Phy-logeny "50 years without K.I. Meyer"]. Max Press, Moscow, Russia, 70-74. (In Russian).
Vinogradova, Yu. K., Mayorov, S.R., Khorun, L.V., 2010. Chernaya kniga flory Sredney Rossii [The Black Book of Flora of Middle Russia]. Geos, Moscow, Russia, 512 p. (In Russian).
Vinogradova, Yu. K., Abramova, L.M., Akatova, T.V. et al, 2015. "Chernaya sotnya" invazionnyh rasteniy Rossii ["Black hundred" of invasive plants of Russia]. Informatsionny bulleten soveta botanicheskih sadov stran SNG [Informational Bulletin of the Council of Botanical Gardens of CIS countries] 4 (27), 85-89. (In Russian).
Zalapa, J.E., Brunet, J., Guries, R.P., 2009. Patterns of hybridization and introgression between invasive Ulmus pumila (Ulmaceae) and native U. rubra. American Journal of Botany 96, 1116-1128.