CC BY
24
HayKoeuü bíchuk ^HYBMET ÍMeni C.3. f^ицbкого
TOM 11 № 3(42) Hacmuna 1, 2009
Liliana Kiczak, Urszula Paslawska, Jacek Bania, Izabela Sambor, Agata
Kochman, Maciej Ugorski ©
From Department of Biochemistry, Pharmacology and Toxicology (L.K., I.S., M.U.)
and Department of Internal and Parasitic Diseases with Clinic for Horses, Dogs and Cats (U.P.) and Department of Food Hygiene and Consumer Protection (J.B.), Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Wroclaw, Poland. Department of Pathological Anatomy, Wroclaw Medical University (A.K.), Wroclaw, Poland
INCREASED EXPRESSION OF INTERLEUKIN-1B NOVEL SPLICE VARIANT IN LIVERS OF DOGS WITH CHRONIC DEGENERATIVE VALVULAR DISEASE (CDVD)
L.K. and U.P. contributed equally to this work
Correspondence to Liliana Kiczak, PhD, Department of Biochemistry, Pharmacology and Toxicology, Faculty of Veterinary Medicine, Wroclaw University of Environmental and Life Sciences, Norwida 31, 50-375 Wroclaw. E-mail: [email protected]
Background - Volume overload frequently caused by chronic degenerative valvular disease (CDVD) leads to the cardiac failure. The lesions primarily observed in left atrium progress to left ventricle, intraventricullar septum and right ventricle. Cardiac insufficiency secondary to mitral valvular noninflammatory mucous degeneration is one of the most important death reason in dogs. However, the etiology of this pathology still remains unclear. Increasing number of experimental and clinical evidences suggest that proinflammatory cytokines, in addition to neurohormonal activation and andrenergic system, are involved in pathogenesis of congestive heart failure (CHF). In addition to the myocardium, other tissues (i.e. liver) seem to contribute to the systematic inflammation characterizing this disorder (1). As we found out up-regulation of the IL-ip (a major proinflammatory cytokine) transcript levels and its transcript variant IL-ipsvi in the heart tissue of dogs with volume overload (2), we decided to prove if novel transcript variant IL-ipsvi increases in CDVD dogs livers.
Methods and Results - In dogs with clinical heart failure (n=8) and control animals (n=7) without the symptoms of cardiac insufficiency the IL-ip transcript variant level in liver was determined in Real-time PCR. Tissue sections from the liver were taken from the dogs presented for euthanasia with informed consent of their owners. Total RNA was prepared from 30-mg canine liver tissue samples using the RNeasy Fibrous Tissue Mini Kit (Qiagen) according to the manufacturer's instructions. The protocol included an on-column DNAse digestion to remove the genomic DNA. First-strand cDNA was synthesized using an SuperScript III First-
© Liliana Kiczak, Urszula Paslawska, Jacek Bania, Izabela Sambor, Agata Kochman, Maciej Ugorski, 2009
218
Науковий вгсник ЛНУВМБТ шен1 С.З. Гжицького Том 11 № 3(42) Частина 1, 2009
Strand Synthesis System using oligo(dT)20 primer (Invitrogen). The svlfor and svlrev primer set was designed using dog IL-ip cDNA (NM_001037971 XM_849577) and genomic sequence (NC006599 REGION: complement 40130937...40135917) with Molecular Beacon Software (Table 1). The relative amount of canine IL-ipsvl RNA was determined by quantitative real-time PCR using the iQ5 Optical System (BioRad) with the iQ SYBR Green Supermix (BioRad). The specificity of the PCR was determined by melt-curve analysis for each reaction. GAPDH was used as a reference gene (Table 1).
Tab. 1. Oligonucleotide primers used in RT-PCR experiments
Target Name Nucleotide sequence of primers (5'^ 3')
sequence
svl IL-ip svlfor GCTCCACATTTCAGAACCTATC
svlrev TTGATGCCCAAGACCACAG
GAPDH SGAPDH TCACTGCCACCCAGAAGA
ASGAPDH TACCAGGAAATGAGCTTGAC
Liver sections from CDVD and control dogs were stained with hematoxylin and eosin (H&E), as well as the Van Gieson (detection of connective tissue collagen) and Mallory (estimation of the fibrosis extent) methods for histopathological evaluation.
Results:
The most significant microscopic changes found in the liver tissue of CDVD animals were as follows: passive congestion, asteatosis and cholestasis. Interstitial and perivascular fibrosis in CDVD liver was only slightly increased comparing to the control group.
Transcript variant IL-ipsv1 in livers from dogs with heart insufficiency was found to be about 6 fold higher than in livers from the control animals (Fig.1).
50 45 40 35 30 25 20 15 10 5 0
control group
CDVD group
Fig. 1 Relative IL-ipsv1 transcript levels in livers in control and CDVD group. mRNA levels were quantified using real-time RT-PCR and normalized against the product of housekeeping gene GAPDH. The Pfaffl method (3) was used to determine the relative expression of the target amplicon with one of the healthy dogs chosen as the calibrator. Data are expressed as mean ± SEM, *P<0.05 vs. control group.
219
Науковий вгсник ЛНУВМБТ шен1 С.З. Гжицького Том 11 № 3(42) Частина 1, 2009
Conclusions - The transcript levels of IL-ip transcript variant IL-ipsvi, up-regulated in failing myocardium of dogs with heart insufficiency is also increased in livers from CDVD animals. As the CDVD dogs liver tissue represents signs of postinflammatory degeneration it could suggest that putative product of IL-ipsvi translation might be involved in systematic inflammation connected with cardiac insufficiency development.
References
1. Yndestadt A, Damas JK, 0ie E, Ueland T, Gullestadt L, Aukrust P, et al. Role of Inflammation in the Progression of Heart Failure. Current Cardiology Reports. 2007;9:236-241.
2. Kiczak L, Paslawska U, Bania J, Ugorki M, Sambor I, Kochman A, Blach J, Chelmonska-Soyta A, Increased expression of interleukin-ib and its novel splice variant in canine hearts with volume overload Cytokine 2008; 44:352-360.
3. Pfaffl MW, Horgan GW, Dempfle L, et al. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative results in real-time PCR. Nucleic Acids Research. 2002;30(9):E36.
Стаття надшшла до редакцИ 24.09.2009
220
