CC BY
5
ASSOCIATION OF CARD8 GENE POLYMORPHISM
AND THE DEVELOPMENT OF EXTRAPULMONARY TUBERCULOSIS
R.A. Jassim1, D.K. Flaifet1*
1 Department of Biology, College of Science, University of AL-Qadisiyah, Iraq;
2 Department of Pathological Analysis, College of Science, AL-Qasim Green University, Iraq.
* Corresponding author: [email protected]
Abstract. Mycobacterium tuberculosis, a species of pathogenic bacteria in the Mycobacteriaceae family, is the infectious agent that causes tuberculosis (TB), one of the most progressive bacterial pathogens in human history. The pathogen is the first cause of mortality linked to a single pathogen worldwide, especially in poor and developing countries. There are two clinical manifestations of disease caused by this bacterium: pulmonary tuberculosis (PTB) and extrapulmonary tuberculosis (EPTB). A single nucleotide polymorphism (SNP) in the human caspase recruitment domain-containing protein 8 (CARD8) gene of TB infection plays a critical role in the disease progression. Combining this SNP with the CARD8 polymorphism increased the effect, indicating a new link between the CARD8 gene and TB infection. The present study was conducted to determine the association between the polymorphism of the CARD8 gene and EPTB infection in humans. The study included patients (males and females) infected with PTB (n = 50), and EPTB (n = 50), as well as 50 healthy individuals as a control group. Blood samples were collected from all the participants and used to isolate DNA. Using a self-designed nested tetra-primer amplification refractory mutation system- polymerase chain reaction (T-ARMS PCR) assay, the genotypes in CARD8 A/T SNPs were identified. The results showed that there were no significant differences between the types of patients themselves and no significant differ- ences between patients and healthy individuals in the results of ARMS-PCR. The findings of the present study re- vealed a correlation between patients with EPTB and polymorphisms in CARD8 (rs2043211).
Keywords: tuberculosis, pulmonary tuberculosis, extrapulmonary tuberculosis, single nucleotide polymorphism, CARD8 gene polymorphism.
List of Abbreviations
TB - Tuberculosis MTB - Mycobacterium tuberculosis PTB - Pulmonary tuberculosis EPTB - Extrapulmonary tuberculosis CARD8 - Caspase recruitment domain-containing protein 8
DNA - Deoxyribonucleic acid EDTA - Ethylene diamine tetra acetic acid T-ARMS - Tetra-primer amplification refractory mutation system
PCR - Polymerase chain reaction SNP - Single nucleotide polymorphism NF-kB - Nuclear factor kappa-B WHO - World Health Organization
Introduction
Tuberculosis (TB) has been present in humans since the oldest human records. It has been estimated that man was infected with the disease as early as three million years ago. Mycobacterium tuberculosis (MTB), the bac-
terium that causes TB, is the second most common infectious cause of death worldwide (WHO, 2016). Today, TB is the leading infectious disease killer globally. In certain parts of the world, TB is out of control, despite a slight drop in estimated incidence over the past few years (Dheda et at, 2018). It continues to be a significant global cause of mortality and morbidity (Ali et at, 2015). Although it can affect other body parts, including the brain or spine, TB primarily affects the lungs (pulmonary TB). The presence of MTB produced in culture is indicative of active TB disease (WHO, 2015). According to Corral-Fernandez et at. (2017), TB is an infectious disease in which the immune system is crucial. The degree to which the disease is eradicated depends on the immune system's power of response (Caval-canti et at, 2012). The two types of clinical manifestations of TB are pulmonary tuberculosis (PTB) and extrapulmonary tuberculosis (EPTB). The former is the most common.
Extrapulmonary tuberculosis refers to TB involving organs other than the lungs (e.g., pleura, lymph nodes, abdomen, genitourinary tract, skin, joints and bones, or meninges). A patient with both PTB and EPTB is classified as a case of PTB. For example, miliary TB is classified as PTB because there are lesions in the lungs. On the other hand, tuberculous intrathoracic lymphadenitis (mediastinal and/or hilar) or tuberculous pleural effusion, without radiographic abnormalities in the lungs, constitutes a case of EPTB (WHO, 2013). Caspase activation and recruitment domain-containing protein 8 (CARD8) are related to inflam-masome-forming PRRs, which only have a predicted N-terminal ~160-amino-acid-long unstructured region followed by a FIIND and a CARD. Near the C-terminal end of their ZU5 subdomains, CARD8 undergoes post-translational auto proteolysis, which results in the production of two non-covalently linked polypeptide chains. The FIINDs of CARD8 are directly bound by the serine proteases DPP8 and DPP9 (DPP8/9) (Griswold et al, 2019). The present study aimed to determine the association between CARD8 gene polymorphism and the development of extrapulmonary tuberculosis.
Materials and Methods
Collection of blood samples
Blood samples were collected from 100 patients suffering from TB at the Center for Thoracic and Respiratory Disease, Diwaniyah, Iraq. The study included 50 healthy individuals as a control group from the blood bank, and the patients included 50 men and women infected with PTB and 50 men and women infected with EPTB. An aliquot of 3 ml of venous blood was collected using an aseptic technique and placed in an ethylene diamine tetra acetic acid (EDTA) tube to extract DNA.
DNA extraction
Genomic DNA from blood samples (frozen) was extracted using a gSYAN DNA extraction kit (Geneaid). The concentration and purity of the isolated DNA were determined using a nanodrop spectrophotometer.
Tetra-primer amplification refractory mutation system-polymerase chain reaction
The tetra-primer amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) is an easy and inexpensive technique for genotyping single nucleotide polymorphisms (SNPs). It employs four primers in a single PCR followed only by gel electrophoresis. However, the optimization stage might be time-consuming and labor-intensive. Two SNPs were chosen with varied amplification conditions. DNA extraction procedures, annealing temperatures, PCR cycle conditions, and primer concentrations were optimized. T-
ARMS-PCR for SNPs in cytosine- and gua-nine-rich DNA regions is common. The melting temperature was deemed to be the most interfering factor. Small changes in reagent concentration, particularly MgCh, significantly influence the PCR. The inner primer band must be adjusted as well. Therefore, the weaker band was identified and enhanced by increasing its concentration to balance the inner primer band. The CARD8 rs2043211 AT SNP gene polymorphism was found and genotyped using the T-ARMS-PCR method in patients with PTB, patients with EPTB, and control samples. Primer sequences for T-ARMS-PCR were obtained from the NCBI-SNP database and the online PRIMER1 design tool for T-ARMS-PCR was used in this study. The primers were obtained from Scientific Researcher Company Ltd, Iraq. The primer sequences and the expected product sizes are shown in Table 1. In general the PCR well applied in many medicine subjects ex: Bassi & Al-Rubaii, 2024; Bresam et al., 2023; Ismael et al., 2023; Abdulrazaq et al, 2022; Ali et al, 2021; Ahmed et al, 2022; Ali et al, 2021; Jawad et al, 2023; Al-Saadi et al, 2023; Saleh et al, 2020; Mohsin & AL-Rubaii, 2023; Jalil et al, 2023; Sabah et al, 2022; Salih et al, 2018; Al-Jumaily et al.,2023; Sultan et al, 2023; Husain & Alrubaii, 2023; Al-saidi et al., 2022; Muhsin et al., 2022.
Statistical analysis
Data were collected, compiled, analyzed, and presented using the statistical package for social sciences (SPSS; version 26) and
Table 1
Nucleotide sequence and amplicon size of the T-ARMS-PCR primers for CARD8 rs2043211 A/T gene polymorphisms
T-ARMS-PCR Primer Sequence (5'-3') Product size
Forward inner primer (T allele) GATAGTTGACACTCAGGAACAGCACGAAT 200 bp
Reverse inner primer (A allele) ATGAGACAGAGGCAGAGCCATTATCGT 175 bp
Forward outer primer CTGAGTTCGATGAAAAACACCCAAATTC 319 bp
Reverse outer primer ATCTTCCTGCACAGCCTATGCTATCATC
Note: T-ARMS: Tetra-primer amplification refractory mutation system; PCR: Polymerase chain reaction; CARD8: Caspase recruitment domain-containing protein 8.
Microsoft Office Excel 2010. Numeric data were presented as mean, standard deviation, and range. The t-test was used to compare mean differences between any two groups of the independent variables, as long as the variable was regularly distributed. The Chi-square test was used to investigate the relationship between two categorical variables. The p-value of significance was set at 0.05 or less, while the level of significance was set at 0.01 or less.
Ethical approval
The research followed the ethical guidelines outlined in the Declaration of Helsinki. The procedure was carried out after receiving the patient's verbal and written consent. Before approving the research protocol, subject information, and consent form, a local ethics commission reviewed and evaluated M36 (dated November 1, 2023)
Results
Detection of CARD8 (rs2043211) A/T polymorphism
The distribution of the CARD8 (rs2043211) A/T polymorphism was detected by the T-ARMS-PCR technique. At this locus, there were three genotypes: AA, AT, and TT. The only allele amplification detected in the wildtype homozygote genotype at 175 bp product size was A. The mutant homozygote genotype showed only T allele amplification at 200 bp product size. Meanwhile, the heterozygote genotype showed A and T allele amplifi-
cation at 175 and 200 bp product size, respectively, as demonstrated in Figure 1. The genotype distribution had no deviation from Hardy-Weinberg equilibrium in all study groups and is consistent with Abate et al. (2019).
m aa tt at at aa tt tt at
2000bp
looobp S»
500bp____ 400bp 300bp 200bp -------
lOObp
Fig. 1. Agarose gel electrophoresis image showing the T-ARMS-PCR products for CARD8 rs2043211 A/T gene polymorphism. M: Marker (2000-100 bp); AA: Wildtype homozygote showing only A allele at 175 bp T-ARMS-PCR product; TT: Mutant homozygote showing only T allele at 200 bp T-ARMS-PCR product; AT: Heterozygote showing both A and T alleles at 175 and 200 bp T-ARMS-PCR product; The outer internal control was observed at 319 bp T-ARMS-PCR product; T-ARMS: Tetra-primer amplification refractory mutation system; PCR: Polymerase chain reaction; CARD8: Caspase recruitment domain-containing protein 8
Genotypic and allelic frequencies of the studied gene in primary pulmonary patients and healthy controls
Table 2 displays the genotypic and allelic frequency comparisons of primary pulmonary patients and healthy controls for the CARD8
Table 2
CARD8 (rs2043211) A/TPOLY genotypic frequencies of primary pulmonary patients
and healthy control
CARD8 (rs2043211) Pulmonary patient N = 50 Control n = 50 P OR 95% CI
Genotypic frequency
TT 8 (16.0%) 2 (4.0%) 0.043* 4.68 0.93-23.53
A/T 7 (14.0%) 7 (14.0 %) 0.785 1.17 0.37-3.66
AA 35 (70.0 %) 41 (82.0%) Reference
Allelic frequency
T 23 (23.0%) 11 (11.0 %) 0.028* 2.41 1.10-5.27
A 77 (77.0 %) 89 (89.0 %) Reference
Note: CARD8: Caspase recruitment domain-containing protein 8; ¥: Chi-square test; *: Significant at p < 0.05.
(rs2043211) A/T SNP. Concerning the mode of genotypes, there was no significant difference in the frequency distribution of genotypes between primary pulmonary patients and healthy controls. The results of the risk analysis showed that the heterozygous A/T genotype was a non-significant risk factor with an OR of 1.17, while the homozygous TT genotype was a significant risk factor (OR = 4.68). This indicates that, compared to patients with other genotypes, those with homozygous TT genotypes are almost five times more likely to acquire primary pulmonary disease. The allele analysis revealed a significant difference (p > > 0.05) between the patient and control groups.
Genotypic and allelic frequencies of the studied gene in extrapulmonary patients and healthy controls
The comparison of genotypic and allelic frequencies concerning CARD8 (rs2043211) A/T SNP between extrapulmonary patients and healthy controls is shown in Table 3. Regarding genotypic mode, there was no significant difference in the frequency distribution of genotypes between extrapulmonary and healthy control. The results of the risk analysis showed that the heterozygous A/T genotype was a non-significant risk factor with an OR of 1.42, whereas the homozygous TT genotype was a significant risk factor with an OR of
5.59. This indicates that patients with a homo-zygous TT genotype are approximately six times more likely to develop extra-pulmonary disease compared with other genotypes. The allele analysis revealed a significant difference (p > 0.05) between the patient and control groups.
The comparison between the types of patients according to ARMS-PCR results
A comparison of the frequency distribution of the types of patient groups according to the results of ARMS-PCR is presented in Table 4. There were no significant differences (p = = 0.912) between the types of patients and the ARMS-PCR results.
The association between ARMS-PCR results and immunological parameter levels in patient groups
The correlation between the results of ARMS-PCR and the levels of immunological parameters in the patient groups (Table 5) revealed that the mean serum IL-1P levels in patients with the AA, AT, and TT genotypes were 697.41 ± 45.83, 667.82 ± 33.75, and 647.71 ± 45.76, respectively. Patients with the mutant genotype (TT) had lower mean serum IL-1P levels than the other groups, but the difference was not statistically significant (p = = 0.435). Also, the mean levels of serum IL-17 were 82.77 ± 9.56, 87.93 ± 7.41, and 88.35 ±
R.A. Jassim, D.K. Flaifel Table 3
CARD8 (rs2043211) A/T POLY genotypic frequencies of extrapulmonary patients and healthy control
CARD8 (rs2043211) Extra-pulmonary n = 50 Control n = 50 P OR 95% CI
Genotypic frequency
TT 9 (18.0%) 2 (4.0%) 0.021* 5.59 1.13-27.6
A/T 8 (16.0%) 7 (14.0 %) 0.535 1.42 0.46 -4.32
AA 33 (66.0 %) 41 (82.0%) Reference
Allelic frequency
T 26 (26.0%) 11 (11.0 %) 0.006* 2.84 1.31-6.13
A 74 (74.0 %) 89 (89.0 %) Reference
Note: CARD8: Caspase recruitment domain-containing protein 8; ¥: Chi-square test; *: Significant at p < 0.05.
Table 4
The comparison of the types of patients according to T-ARMS-PCR results
Characteristics AA genotype AT genotype TT genotype P
Type of patients
Pulmonary, n (%) 35 (70.0%) 7 (14.0 %) 8 (16.0 %) 0.912 ¥ NS
Extrapulmonary, n (%) 33 (66.0%) 8 (16.0 %) 9 (18.0 %)
Note: T-ARMS: Tetra-primer amplification refractory mutation system; PCR: Polymerase chain reaction; ¥: Chi-square test; NS: Not significant at p > 0.05.
Table 5
The association between ARMS-PCR results and immunological parameter levels
in patient groups
Immunological parameters ARMS-PCR results
AA genotype AT genotype TT genotype P value
IL-1ß
Mean ± SD 697.41 ± 45.83 667.82 ± 33.75 647.71 ± 45.76 0.435 t NS
Range 460.15 - 914.97 468.78 - 901.24 340.01 - 901.24
IL-17
Mean ± SD 82.77 ± 9.56 87.93 ± 7.41 88.35 ± 8.03 0.224 t NS
Range 64.38 - 99.27 73.20 - 97.69 75.97 - 99.27
Note: T-ARMS: Tetra-primer amplification refractory mutation system; PCR: Polymerase chain reaction; n: number of cases; SD: Standard deviation; f: One-way analysis of variance (ANOVA); NS: Not significant at p > 0.05.
± 8.03, in patients with AA, AT, and TT genotype (TT) were higher than in the other genotypes, respectively. However, the mean groups, but the difference was not statistically serum IL-17 levels in patients with the mutant significant (p = 0.224).
Discussion
Caspase recruitment domain-containing protein 8, a member of the CARD family, is encoded by the CARD8 gene located on chromosome 19q13.33. The CARD contains a conserved homologous domain that can mediate the protein-protein interactions among key apoptotic signalling molecules and participate in the nuclear factor kappa-B (NF-kB) signaling pathway via mediating the interactions of components in the upstream part of the pathway (La Russa et al., 2023). It has been demonstrated lately that CARD8 is a selective suppressor of the assembly of the NLRP3/ASC/procaspase-1 protein, which prevents the activation of the NLRP3-inflammasome. According to Ito et al. (2014), the polymorphism in CARD8 leads to a truncated, non-functional protein with a loss in CARD8--mediated inhibition of caspase-1. The polymorphism (rs2043211) related to CARD8 genetic variations has been the subject of considerable research. It has been linked to is-chemic stroke (Bai et al, 2014) and an elevated risk of gout in European and Chinese populations (McKinney et al., 2015). It is a nonsense mutation with an A-to-T transition, which leads to a severely truncated protein that cannot act as a negative regulator of the NLRP3 inflammasome. The expression of NLRP3 was linked to rs2043211, which was anticipated to not localize in enhancer histone markers (GTEx Consortium, 2020).
Pulmonary and extrapulmonary TB are commonly manifested as generalized infections with higher rates of inflammation and a stronger pro-inflammatory reaction. In patients with active TB, a hyper-reactive inflam-masome may drive the inflammatory state, which could prolong the time to cure (Cara-baH-Isajar et al., 2023). To the best of our knowledge, this is the first study conducted in Iraq where many genetic models, including CARD8 (rs2043211), were significantly linked to an elevated vulnerability to pulmonary and extrapulmonary risk. Genetic variation in CARD8 influences the risk of acquiring pulmonary and extrapulmonary conditions. It is interesting to note that CARD8 (rs2043211) all
clearly elevated the risk of pulmonary and ex-trapulmonary risks in Al-Diwaniyah populations aged from 15 to 76 years old. The current investigation reveals that frequent genetic variations within CARD8 (rs2043211) increase the risk of extrapulmonary and pulmonary complications in the Iraqi population. Previous studies examined the functions of CARD8 (rs2043211) polymorphisms in extrapulmo-nary patients, which were corroborated by functional data indicating CARD8 malfunction (Abate et al, 2019). The findings of this study serve as a novel replication and strengthen the observed association between CARD8 (rs2043211) and pulmonary and extrapulmo-nary diseases. In a relatively short period, several research groups have worked on the importance of CARD8 (rs2043211) polymorphisms and suggested a strong association with disease development (Pang et al, 2021). Caspase recruitment domain-containing protein 8 has several well-known SNPs, such as rs2043211 and rs11672725.
To find out if genetic variants in CARD8 (rs2043211) might be a potential genetic marker to predict the susceptibility of pulmonary and extrapulmonary diseases, CARD8 (rs2043211) was chosen, and their genetic associations with pulmonary and extrapulmonary risk were evaluated using T-ARMS-PCR analysis. The study assessed the frequencies of the CARD8 (rs2043211) gene and alleles in 50 pulmonary patients, 50 extrapulmonary patients, and 50 healthy controls (Fig. 1). In terms of pulmonary disease, the distribution of CARD8 (rs2043211) genotypic frequencies between patients with pulmonary disease and healthy controls shows generally statistically significant differences. These findings suggested a higher risk of developing lung disease is linked to the CARD8 (rs2043211) polymorphism as indicated by the frequencies of the AA (35 and 41), AT (7 and 7), and TT (8 and 2) genotypes among pulmonary cases and controls, respectively. The CARD8 (rs2043211) polymorphism was significantly associated with a high risk of pulmonary disease (TT vs AA: OR = 4.68; 95% CI = 0.93-23.53; AT vs AA: OR = 1.17; 95% CI = 0.37 -3.66). Among
patients with pulmonary disease, the TT genotype was more prevalent in 8 cases (16.0%), suggesting a high carrier prevalence of this allele in the current study population. However, the current findings demonstrated a substantial correlation (OR = 2.41; 95% CI 1.105.27) between the CARD8 (rs2043211) variant T allele and an increased risk of pulmonary disease. Concerning extra pulmonary disease, the distribution of CARD8 (rs2043211) genotypic frequencies between patients with ex-trapulmonary disease and healthy controls shows generally statistically significant differences. These findings suggested a higher risk of extrapulmonary disease is linked to the CARD8 (rs2043211) polymorphism. These findings are consistent with those of Abate et al. (2019), who demonstrated that rs2043211 in CARD8 was likewise discovered to be a significant risk gene for patients in the Ethiopian community who had active TB. Furthermore, they showed that AT heterozygotes in CARD8 (rs2043211) exhibited a significantly reduced ability to limit the growth of M. tuberculosis. In contrast to healthy blood donors from Ethiopia, a different study discovered a much greater incidence of CARD8 TT homozygotes in TB patients. This suggests that CARD8 contributes to the unexplained high rate of TB in this region (Berg et al., 2015). The frequencies of the AA, AT, and TT genotypes were 33, 8, and 9 among extrapulmonary cases, respectively, and 41, 7, and 2 in controls, respectively. A significant association was found between the CARD8 (rs2043211) polymorphism and a high risk of pulmonary disease (OR = 5.59 for TT vs AA; 95% CI =
= 1.13-27.6; OR = 1.42 for AT vs AA; 95% CI = 0.46-4.32). Among patients with extrap-ulmonary disease, the TT genotype was more prevalent in 9 cases (18.0%), suggesting a high carrier prevalence of this allele in the current study population. However, the current findings demonstrated a significant association (OR = 2.84; 95% CI 1.31-6.13) between the CARD8 (rs2043211) variant T allele and an increased risk of extrapulmonary disease. In line with the current findings, Abate et al. (2019) demonstrated that patients with active TB had a high risk due to the T allele, with an OR = 1.1 (0.50-2.4). The association between the findings of ARMS-PCR and the levels of immunological markers indicates that patients with mutant genotypes (TT) had mean serum IL-1P levels that were lower than those of other groups, but the differences were not statistically significant (p = 0.435). However, patients with the mutant genotype (TT) had mean serum IL-17 levels greater than those of other groups, but this difference was not statistically significant (p = 0.224). Caspa-se recruitment domain-containing protein 8, which suppresses innate immune responses, inflammation, and apoptosis by lowering the activation of nuclear factor-KB (NF-kB) and caspase-1, reduces the production of IL-1P (La Russa et al, 2023).
Conclusion
The findings of the present study discovered a correlation between individuals with pulmonary and extrapulmonary TB and polymorphisms in CARD8 (rs2043211), which results in a more susceptible inflammasome.
References
ABATE E., BLOMGRAN R., VERMA D., LERM M., FREDRIKSON M., BELAYNEH M., SODERKVIST P., STENDAHL O. & SCHON T. (2019): Polymorphisms in CARD8 and NLRP3 are associated with extrapulmonary TB and poor clinical outcome in active TB in Ethiopia. Scientific reports 9(1), 3126.
ABDULRAZAQ RA., MAHMOOD WS., ALWAN B., SALEH T.H., HASHIM S.T. & AL-RUBAII B.A.L. (2022): Biological study of protease produced by clinical isolates of Staphylococcus aureus. Research Journal of Pharmacy and Technology 15(12), 5415-5420.
AHMED A.A., KHALEED K.J., FADHEL A.A. & Al-RUBAII B.A.L. (2022): Chronic Myeloid Leukemia: A retrospective study of clinical and pathological features. Bionatura 7(3), 41.
AII M.A. & Al-RUBAII B.A. (2021): Study of the Effects of Audible Sounds and Magnetic Fields on Staphylococcus aureus Methicillin Resistance and mecA Gene Expression. Tropical Journal of Natural Product Research 5(5), 825-830.
ALI R.M., AL-THWANI A.N., CIRILLO D M., BORRONI E. & MANKHI A.A. (2015): Molecular characterization of multi-drug-resistant tuberculosis isolated from Baghdad, Iraq. International Journal of Mycobacteriology 4(1), 54-55.
ALI S.M., LAFTAH B.A., Al-SHAMMARY A.M. & SALIH H.S. (2021): Study the role of bacterial neuraminidase against adenocarcinoma cells in vivo. In AIP Conference Proceedings 2372(1), AIP Publishing 030009. https://doi.org/10.1063/5.0067193.
AL-JUMAILY R.M.K, AL-SHEAKLI I.I, MUHAMMED H.J & AL-RUBAII B.A.L (2023): Gene expression of Interleukin-10 and Foxp3 as critical biomarkers in rheumatoid arthritis patients. Biomedicine (India) 43(4), 1183-1187
AL-SAADI HK, AWAD HA, SALTAN ZS, HASOON BA, ABDULWAHAB AL, AL-AZAWI KF, AL-RUBAII B.A.L (2023): Antioxidant and Antibacterial Activities of Allium sativum Ethanol Extract and Silver Nanoparticles. Tropical Journal Natural Product Research 7(6), 3105-3110.
Al-SAIDI M., Al-BANA R.J.A., HASSAN E. & Al-Rubaii B.A.L. (2022): Extraction and characterization of nickel oxide nanoparticles from Hibiscus plant using green technology and study of its antibacterial activity. Biomedicine 42(6), 1290-1295.
BAI Y., NIE S., JIANG G., ZHOU Y., ZHAO Y., LI S., WANG F., LY Q., HUANG Y. & YANG Q. (2014): Regulation of CARD8 Expression by ANRIL and Association of CARD8 Single Nucleotide Polymorphism Rs2043211 (p.C10X) with Ischemic Stroke. Stroke 45(2), 383-388.
BASSI A.G.H. & Al-RUBAII B.A.L. (2024): Detection of Pyocin S and the Effects of Lactobacillus Acidophilus Cell-Free Supernatants on Multi-Drug Resistant Pseudomonas Aeruginosa Isolated from Patients of Baghdad Hospitals. Journal of Communicable Diseases 56(1), 135-144.
BERG S., SCHELLING E., HAILU E., FIRDESSA R., GUMI B., ERENSO G., GADISA E., MENGISTU A., HABTAMU M., HUSSEIN J. & KIROS T. (2015): Investigation of the high rates of extrapulmo-nary tuberculosis in Ethiopia reveals no single driving factor and minimal evidence for zoonotic transmission of Mycobacterium bovis infection. BMC infectious diseases 15, 112.
BRESAM S., ALHUMAIRI R.M.A.U., HADE I.M. & AL-RUBAII B.A.L. (2023): Genetic mutation rs972283 of the KLF14 gene and the incidence of gastric cancer. Biomedicine (India) 43(4), 1256-1260.
CAVALCANTI Y.V.N., BRELAZ M.C.A., NEVES JKDLN. FERRAZ JC. & PEREIRA V.R.A. (2012): Role of TNF-alpha IFN-gamma and IL-10 in the development of pulmonary tuberculosis. Pulmonary Medicine 28, 1-10.
CORRAL-FERNANDEZ N.E., CORTES-GARCÍA J.D., BRUNO R., ROMANO-MORENO S., MEDEL-LÍN-GARIBAY S.E., MAGANA-AQUINO M., SALAZAR-GONZ ALEZ R A., GONZ ALEZA-MARO R. & PORTALES-PEREZ D P. (2017): Analysis of transcription factors microRNAs and cy-tokines involved in T lymphocyte differentiation in patients with tuberculosis after directly observed treatment shortcourse. Tuberculosis 105, 1-8.
DHEDA K., COX H., ESMAIL A., WASSERMAN S., CHANG KC. & LANGE C. (2018): Recent controversies about MDR and XDR-TB: Global implementation of the WHO shorter MDR-TB regimen and bedaquiline for all with MDR-TB? Respirology 23(1), 36-45.
FAKHRY S.S, HAMMED Z.N., BAKIR W.A.E. & AL-RUBAII B.A.L (2022): Identification of methicil-lin-resistant strains of Staphylococcus aureus isolated from humans and food sources by Use of mecA 1 and mecA 2 genes in Pulsedfield gel electrophoresis (PFGE) technique. Bionatura 7(2) 44. http://dx.doi.org/10.21931/RB/2022.07.02.44.
GTEX Consortium (2020): The GTEx Consortium Atlas of Genetic Regulatory Effects across Human Tissues. Science 369, 1318-1330.
HUSSAIN, A.G. & ALRUBAII, B.A.L. (2023): Molecular detection and expression of virulence factor encoding genes of Pseudomonas aeruginosa isolated from clinical samples. Biomedicine 43(5), 1514-1519.
ISMAEL M.K., QADDOORI Y.B., SHABAN M.N. & AL-RUBAII B.A.L. (2023): The Immunohisto-chemical Staining of Vimentin and E-Cadherin in Bladder Cancer Patients Infected with Hepatitis C Virus. Journal of Pure and Applied Microbiology 17(2), 1009-1016.
ITO S., HARA Y. & KUBOTA T. (2014): CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction. Arthritis Res Ther 16, R52.
JALIL I S., MOHAMMAS S Q., MOHSEN A.K. & AL-RUBAII B.A.L (2023): Inhibitory activity of Mentha spicata oils on biofilms of Proteus mirabilis isolated from burns. Biomedicine (India) 43(2), 748-752.
JAWAD N.K., NUMAN AT., AHMED A G., SALEH T.H. & AL-RUBAII B.A.L. (2023): IL-38 gene expression: a new player in Graves' ophthalmopathy patients in Iraq. Biomedicine 43(1), 210-215.
LA RUSSA A., LOFARO D., MONTESANTO A., LA RUSSA D., ZAZA G., GRANATA S., DI DIO M., SERRA R., ANDREUCCI M., BONOFIGLIO R. & PERRI A. (2023): Association between NLRP3 rs10754558 and CARD8 rs2043211 Variants and Susceptibility to Chronic Kidney Disease. International Journal of Molecular Sciences 24(4), 4184.
MCKINNEY C., STAMP L.K., DALBETH N., TOPLESS R.K., DAY R.O., KANNANGARA D.R., WILLIAMS K.M., JANSSEN M., JANSEN TL., JOOSTEN L A. & RADSTAKE T.R. (2015): Multiplicative Interaction of Functional Inflammasome Genetic Variants in Determining the Risk of Gout. Arthritis research & therapy 17, 288.
MOHSIN M.R. & AL-RUBAII B.A.L (2023): Bacterial growth and antibiotic sensitivity of Proteus mirabilis treated with anti-inflammatory and painkiller drugs. Biomedicine 43(2), 728-734.
MUHSIN H.Y., Al-HUMAIRI R.M., ALSHAREEF D.Q. & AD'HIAH A H. (2022): Interleukin-22 is up-regulated in serum of male patients with ankylosing spondylitis. The Egyptian Rheumatologist 44(4), 351-355.
PANG H., SUN X., LUO S., LIN J., SHI X., XIAO Y., HUANG G., LI X., XIE Z. & ZHOU Z. (2021): The polymorphism of the CARD8 inflammasome-related gene is associated with glutamic-acid-decarboxylase-antibody positivity in patients with type 1 diabetes mellitus. Annals of translational medicine 9(14), 1131.
SALEH T.H., HASHIM S., ABDULRAZAQ ALOBAIDI R.A. & AL-RUBAII B.A.L. (2020): A biological study of chitinase produced by clinical isolates of Pseudomonas aeruginosa and detection of chia responsible gene. International Journal of Research in Pharmaceutical Sciences 11(2), 1318-1330.
SALIH H.S., AL-SHAMMARI A.M. & AL-RUBAII B.A.L. (2018): Intratumoral co-administration of on-colytic newcastle disease virus and bacterial hyaluronidase enhances virus potency in tumor models. Journal of Global Pharma Technology 10(10), 303-310.
SUTAN R S., ALKHAYALI B D., ABDULMAJEED G.M. & AL-RUBAII B.A. (2023): Exploring Small Nucleolar RNA Host Gene 3 as a Therapeutic Target in Breast Cancer through Metabolic Reprogramming. Opera Medica etPhysiologica 10(4), 36-47.
WORLD HEALTH ORGANIZATION (2013): Systematic screening for active tuberculosis: principles and recommendations. World Health Organization.
WORLD HEALTH ORGANIZATION (2015): I Guidelines on the management of latent tuberculosis infection. World Health Organization.Available at: https://www.who.int/tb/publications/latent-tuberculosis-infection/en/.
WORLD HEALTH ORGANIZATION (2015): Tracking universal health coverage: first global monitoring report. World Health Organization.
WORLD HEALTH ORGANIZATION (2016): Global tuberculosis report. World Health Organization. Available at: http://www.who.int/tb/publications/global%20report/en/.
